Skip to main content

Advertisement

Table 1 Primer and probe sequences

From: An optimized rapid bisulfite conversion method with high recovery of cell-free DNA

Primer/probe Sequence (5′–3′)
MLH1 UF TGTGAIAAAAAATGTGAAGGG
MLH1 DF GAAGATATTAGATTTTATGGGTTATTT
MLH1 R CAACTIATTTTAACAAAATAATCT
MLH1 UDF ACCAGATTTTATGGGTCATCC
MLH1 PROBE (FAM)CGCGAATGTGGAAGGAAAAGTGAGTGTCGC(TAMRA)
MTND4P12 UF TAGTAGGTTAATAGTGGGG
MTND4P12 R ACTTACATCCTCATTACTATTCT
MTND4P12 PROBE (FAM)CGCGATTAGTGGGAGTAGGGTTTGAAGTCGC(TAMRA)
RASSF1A UF GTTTTGGTAGTTTAATGAGTTTAGGTT
RASSF1A R CCCCACAATCCCTACACCCAAAT
RASSF1A PROBE (FAM)CGCGATGGATYYTGGGGGAGGTCGCG(TAMRA)
  1. MLH1 UF and MLH1 R concurrently amplify total deaminated and undeaminated MLH1 promoter. MLH1 DF and MLH1 R amplify deaminated MLH1. MLH1 UDF and MLH1 R amplify undeaminated MLH1 promoter. A common MLH1 probe was used for detection of the three products. MTND4P12 UF and MTND4P12 R amplify the MTND4P12 sequence regardless of the deamination. RASSF1A UF and RASSF1A R amplify total deaminated and undeaminated RASSF1A sequence