Skip to main content

Advertisement

Table 1 DNA sequences used in this study

From: Identification of G-quadruplex structures that possess transcriptional regulating functions in the Dele and Cdc6 CpG islands

Name Sequences (5′–3′)
Jard2 GTGAGGCTAGGGGGTGGTGGTGGTGGGGGTGAGGAAGGGAAAGAT
Dele ATAGCGCCAGTGGGTGGGCTTAGATCTGGGAAGGGCGGGACAGAG
Foxa2 GTCCAGGAAGGCTAGAGGTGGG GGGGCGGGTACCGGTGAAGGGAG
Chd4 TAAAGAGGAGGGTGGCGGTAGTGGAGGGGGGGGTTGGAGTTGGTT
Ntpcr CTTGTGTGTCGGGAAGGG GGGGGGGGGAGCGTTGGAAACGCATGC
Med4 ACTTGGGTAGGCGGGCTTGGGAGGCTCCGTTGGACGTGGGGTCTA
Bmi1 CACTCTTTTTG GG GTTGGGACTGAGGTGGCGGTCACGCGAGGATC
Wt1 AGTAGGGAGCTTTGGAATGAGGGATTAACACTTTGGGGGACTTAGTC
Sp130 AGGGGTAGGTTGGGTGGTAAGAGGTGGTAAGCGGAGCGGCTGCTG
Cdc6 TGGGGAGGCTGGGTGGAGGACAAAGTAGAAATAAAAATACGGAAGTAGAT
  1. Guanine runs, which form the G-quadruplex structures, are shown in bold and mutation sites are underlined