Skip to main content

Advertisement

Table 2 Primers used in this study

From: Mitochondrial RNA processing in absence of tRNA punctuations in octocorals

Gene 5′ RACE Sequence 3′ RACE Sequence
A. Primers used in 5′ and 3′ RACE amplification
 COI C1-839a ATCATAGCATAGACCATACC   
C1-1144 CATAGTGGAAGTGAGCTACTAC   
 CytBND6 CB-4128a GCTCCCCAAAAGGACATTTGTC   
 ND3ND4mtMutS N3-5602 CACATTCATAGACCGACACTT N4L-6071 GCCATTATGGTTAACTATTAC
M-6402 ACGAAGCAACTTGTTCAATGG M-6363 ATTGAACAAGTTGCYTCGTTACTTG
M-6719 CCGGGTTACTTTGTCCCTGTCCG M-8714 GCCCTCTCAATATGGCATTG
   M-6655 CAGCCATGAATGGGCATAG
   M-8067 GCATTAAGCGGGGCTATTGCGG
 COII C2-18519 CCATAACAGGACTAGCAGCATC   
  1. aIndicates the other primers used for RT during cRT-PCR
Gene 3′ Facing Sequence 5′ Facing Sequence
B. Primers used in cRT-PCR
 COI C1-1324 TACTCGGATTTCCCTGATGC C1-251 AACCAATTTCCGAATCCTCCG
 CytBND6 N6-4962 TTTGGTTAGTTATTGCCTTT CB-4128a GCTCCCCAAAAGGACATTTGTC
 ND3ND4mtMutS M-8624 TGATTCGCCAGTTCGGTGCT M-6780a TTAAACCTACCCCCGAGTCC
 ND2ND5 N5-14119 GCTCAGTTTGGAAGTTTGGC N2-11753a ACATCGGGAGCCCACATA
 ND4 N4-15714 TTTTGGGCAACTTTCTCC N4-14532 CAGAGACCACTCTAACGCTTGTTG
 COIIATP8ATP6 C2-18161 GGTTGAAGGTCACTCGTAGGTATC A6-17048 GGGTTCGCAATGATTAGTAATGGAATGT
  1. aIndicates the other primers used for RT during cRT-PCR
Gene Primer Sequence
C. Gene-specific primers used for RT for cRT-PCR analysis
 ATP6 A6-17092 TTAGCAGCCAATCGAACACC
 ND4 N4-15295 GCGTCTACCTGTCTGCAAGT
 mtMutS M-8826 CATTTCGGGATGGTAGCTCC
  1. aIndicates the other primers used for RT during cRT-PCR