Skip to main content

Advertisement

Table 1 List of primers used for bisulfite PCR and qRT-PCR

From: RUNX1 induces DNA replication independent active DNA demethylation at SPI1 regulatory regions

Bisulfite primers
 SPI1 proximal promoter (Fwd) GAGATTTTTTGTATGTAGTGTAAGA
 SPI1 proximal promoter (Rv) TAACTTCCCACTAATAACAAACCA
 SPI1 −17-kb URE (Fwd) GTTGGATATTTTTTTGAGGTTTGG
 SPI1 −17-kb URE (Rv) TAAAACCTAAAACTACTAAACCCA
Real-time primers
 GAPDH (Fwd) GAAATCCCATCACCATCTTCCAGG
 GAPDH (Rv) GAGCCCCAGCCTTCTCCATG
 SPI1 (Fwd) TCCTGAGGGGCTCTGCATT
 SPI1 (Rv) TGTCATAGGGCACCAGGTCTT