Skip to main content

Table 1 Name, primer sequences, and product size of candidate reference genes

From: Identification of suitable reference genes for real-time quantitative PCR analysis of hydrogen peroxide-treated human umbilical vein endothelial cells

Symbol Gene name Primer sequences (forward/reverse) Product length (bp)
18S 18S ribosomal RNA CGGCTACCACATCCAAGGAA/GCTGGAATTACCGCGGCT 186
GAPDH Glyceraldehyde-3-phosphate dehydrogenase GACAGTCAGCCGCATCTTCT/TTAAAAGCAGCCCTGGTGAC 120
U6 U6 snRNA AACGCTTCACGAATTTGCGT/CTCGCTTCGGCAGCACA 109
ALAS1 5′-Aminolevulinate synthase 1 GGCAGCACAGATGAATCAGA/CCTCCATCGGTTTTCACACT 150
ACTB Actin, beta  AGAAAATCTGGCACCACACC/TAGCACAGCCTGGATAGCAA 173
TFRC Transferrin receptor GTCGCTGGTCAGTTCGTGATT/AGCAGTTGGCTGTTGTACCTCTC 80
PPIA Peptidylprolyl isomerase A AGACAAGGTCCCAAAGAC/ACCACCCTGACACATAAA 118
RPLP0 Ribosomal protein lateral stalk subunit P0 CCATTCTATCATCAACGGGTACAA/TCAGCAAGTGGGAAGGTGTAAT 75
PBGD Hydroxymethylbilane synthase AGTGTGGTGGGAACCAGC/CAGGATGATGGCACTGAACTC 144
GUSB Glucuronidase beta AGCCAGTTCCTCATCAATGG/GGTAGTGGCTGGTACGGAAA 160
B2M Beta-2-microglobulin AGCGTACTCCAAAGATTCAGGTT/ATGATGCTGCTTACATGTCTCGAT 206
HPRT1 Hypoxanthine phosphoribosyl transferase 1 GACCAGTCAACAGGGGACAT/CCTGACCAAGGAAAGCAAAG 132
RPL29 Ribosomal protein L29 GGCGTTGTTGACCCTATTTC/GTGTGTGGTGTGGTTCTTGG 120
PUM1 Pumilio RNA binding family member 1 CAGGCTGCCTACCAACTCAT/GTTCCCGAACCATCTCATTC 211
TBP TATA-box binding protein TGCACAGGAGCCAAGAGTGAA/CACATCACAGCTCCCCACCA 132