Skip to main content

Advertisement

Table 4 The read counts and sequences of A. gossypii miRNAs that had increased expression following plant allelochemical treatment

From: Identification of microRNAs and their response to the stress of plant allelochemicals in Aphis gossypii (Hemiptera: Aphididae)

miRNA name miRNA sequence Control 2-tridecanone Tannic acid Quercetin Gossypol
Ago-miR-8798a CGCGGTCGCCGCGCCGCC 116 199 117 154 162
Ago-miR-331-3p GCCCCTGGTGGTCATGTTGGA 39 58 56 57 42
Ago-miR-3191-3p GGGGGACGAGGTGGCCGAGCGGT 37 39 45 60 54
Ago-miR-1773-5p GGGGGGAGGAGGAGGAGGA 19 41 75 36 39
Ago-miR-2179-5p ATGCAAAATACATTTGTGTACT 27 66 32 45 35
Ago-miR-92b-5p CGGGACGGCGAGGGTTGGGG 16 36 64 30 31
Ago-miR-719 CTCTCGGCCGTCGGCGCGGC 2 6 3 6 5
Ago-miR-9083-2 GGCCACGCCGCGCCGTCGG 1 5 2 5 4
Ago-miR-7475a-5p CGCCACCGCCGCGCCGTCGT 0 6 2 13 5