Skip to main content

Advertisement

Table 1 The eIF4E isoforms used throughout this study and primers used to clone the corresponding cDNA

From: Distinct recruitment of human eIF4E isoforms to processing bodies and stress granules

Gene Protein isoform Primer sequence Restriction site Protein variant (Acc. No./GI) Encoded by transcript variant (Acc. No./GI):
eIF4E1 1 fwd CGAAGAAGATCTATGGCGACTGTCGAACCGG BglII NP_001959.1 GI:4503535 1 NM_001968.3 GI:194578905
rev GCGCGGTACCTTAAACAACAAACCTATTTTTAGTGGTGG Acc65I
3 fwd TTGTCGACATGTTGGACCTGACCTCCCGC SalI NP_001124150.1 GI:194578907 3 NM_001130678.1 GI:194578906
rev GCGCGGTACCTTAAACAACAAACCTATTTTTAGTGGTGG Acc65I
eIF4E2 A fwd GTGTCGACATGAACAACAAGTTCGACGCTTTGAAAGATG SalI NP_004837.1 GI:4757702 1 NM_004846.3 GI:545309374
rev GGGTACCTCATGGCACATTCAACCGCGGCTTC Acc65I
C fwd GTGTCGACATGAACAACAAGTTCGACGCTTTGAAAGATG SalI NP_001263265.1 GI:545309640 3 NM_001276336.1 GI:545309639
rev CCGGTACCTCACAATGTGATTTTTGTATTTCGAAAGC Acc65I
CRA_a fwd GTGTCGACATGAGTTTGAAAGATGATGAC SalI EAW71007.1 GI:119591413   not annotated yet
rev CCGGTACCTCACAATGTGATTTTTGTATTTCGAAAGC Acc65I
eIF4E3 A* fwd CGGAGAAAATGGCGCTGCCC X NP_001128123.1 GI:197382708 1 NM_001134651.1 GI:197382707
rev ACTGTGGACGTGCTGTCCTTGG X
B fwd GTGTCGACATGAGAGGAGAGAGGCGACCACTTTG SalI NP_775495.1 GI:27659734 2 NM_173359.4 GI:197382627 NM_001134649.2 GI:544583504 NM_001134650.1 GI:197382663 NM_001282886.1 GI:544583491
NP_001128121.1 GI:197382649 3
NP_001128122.1 GI:197382664 4
rev CCGGTACCTTAGTGTTTTCCACGTCCACCTTCAAAAG Acc65I NP_001269815.1 GI:544583492 5
  1. * Indicates primers used for the amplification of the 3′-incomplete coding sequence of eIF4E3_A from HEK293-cell cDNA; the complete ORF was obtained in subsequent cloning steps