Skip to main content

Table 1 Primer sequences used for RT-PCR

From: microRNA-150 promotes cervical cancer cell growth and survival by targeting FOXO4

Gene Primer (forward) 5′–3′ Primer (reverse) 5′–3
GAPDH CGCTCTCTGCTCCTCCTGTT CCATGGTGTCTGAGCGATGT
CyclinD1 CAATGACCCCGCACGATTTC CATGGAGGGCGGATTGGAA
p27 AACGTGCGAGTGTCTAACGG CCCTCTAGGGGTTTGTGATTCT
FASL CTCCGAGAGTCTACCAGCCA TGGACTTGCCTGTTAAATGGG
BIM TAAGTTCTGAGTGTGACCGAGA GCTCTGTCTGTAGGGAGGTAGG