Skip to main content

Table 1 Zebrafish tRFs identified by deep sequencing

From: Conserved and highly expressed tRNA derived fragments in zebrafish

tRF ID Sequence (5′–3′) Nr of reads Expression
5′tRF-LysTTT GCCCGGATAGCTCAGTCGGTAGAGCATCAG 4 Adult tissues
5′tRF-ValCAC GTTTCCGTAGTGTAGTGGTTATCACGTTCG 4 Adult tissues
5′tRF-GluCTC TCCCTGGTGGTCTAGTGGTTAGGATTCGGC 26 Development, adult tissues
5′tRF-ProCGG TAGGGGTATGATTCTCGC 12 Development, adult tissues
3′tRF-AlaAGC AGAGGTAGCGGGATCGTTGCCC 16 Adult tissues
3′tRF-LysCTT CAGGGTCGTGGGTTCGAGCCCC 4 Adult tissues
3′tRF-IleAAT CAAGGTCGCGGGTTCGTTCCCC 6 Adult tissues
3′tRF-GluCTC TCGATTCCCGGTCAGGGAACCA 24 Development, adult tissues
3′tRF-ProAGG TCCCGGACGAGCCCCCA 13 Development, adult tissues
3′tRF-ArgTCG GTCCCTTCGTGGTCGCCA 7 Adult tissues
  1. tRF identification, sequence, number of reads and expression are shown