Skip to main content

Table 2 Oligonucleotides used in this study

From: Nop17 is a key R2TP factor for the assembly and maturation of box C/D snoRNP complex

Oligonucleotide Sequence Reference
5Srev GCGAGGCAAATCCTGAAAATTT Granato et al. [15]
U3 promfor CGAAGGCAAATCCTGAAAATTT This study
U3 promrev TTGACAGCAGAATACAAAGCCTTT This study
U3 exon1for TCAACCATTGCAGCAGCTTT Coltri et al. [39]
U3 exon1rev TCTGCTCCGAAATGAAAACTCTAGTA Coltri et al. [39]
U3 exon2for TCTATAGGAATCGTCACTCTTTGACTC Coltri et al. [39]
U3 exon2rev GACCAAGCTAATTTAGATTCAATTTCGG Coltri et al. [39]
U3RevFISH ATGGGGCTCATCAACCAAGTTGG This study