Skip to main content

Table 1 Primer information

From: Wnt antagonist, secreted frizzled-related protein 1, is involved in prenatal skeletal muscle development and is a target of miRNA-1/206 in pigs

Gene Primer sequence (5′-3′) Size (bp)
SFRP1-CDS F: ACCCAGGTCTTCCTCTGCTCG 247
  R: TTGGAGGCTTCGGTGGCATT  
SFRP1-3′UTR F: CTCGAGTTCTTCTAGTTCCTTCCGTAGCACC 230
  R: GCGGCCGCCGAGTGAATATTGATACATGGCAGG  
GAPDH F: ATGGTGAAGGTCGGAGTGAAC 235
  R: CTCGCTCCTGGAAGATGGT  
SFRP1 (mut-1) F: CTCGAGTTCTTCTAGTTCCTTCCGTAGCACC 103
  R: ACAACAACACACCAATGAAATAAAACGTTTTCACAGTATT  
SFRP1 (mut-2) F: AATACTGTGAAAACGTTTTATTTCATTGGTGTGTTGTTGT 174
  R: GCGGCCGCCGAGTGAATATTGATACATGGCAGG  
miR-206 F: GGGTGGAATGTAAGGAA 61
  R: CTCAACTGGTGTCGTGGAGTC  
U6 F:GCTTCGGCAGCACATATACTAAAAT 89
  R:CGCTTCACGAATTTGCGTGTCAT  
miR-206 -RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCACACAC
U6-RT CGCTTCACGAATTTGCGTGTCAT