Skip to main content

Table 1 Designations and sequences of oligonucleotides

From: Complex organisation and structure of the ghrelin antisense strand gene GHRLOS, a candidate non-coding RNA gene

Name Sequence (5'-3') GHRLOS Exon Ta (°C) PCR Cycles
5'2-out-F GATGGCGATGAATGAACACTG N/A   
5'2-out-R AATCATCTCAGGAATACCTGGA 2 60 35
5'2-in-F ATGAATGAACACTGCGTTTGC N/A   
5'2-in-R AAATGGAAGAGATGAGGCGC 2 61 35
Ex1-cRNA-F CATACAGTTTGAACATTTATTCGCCTCC 1   
Ex1-cRNA-R CTAATACGACTCACTATAGGGAGA CTCTCTCTAAGTTTAGAAGCGCTCATCTG 1 62 25
3'2OF GAGAGCGCCTCATCTCTTCC 2   
3'2OR GCGAGCACAGAATTAATACGACTC N/A 63 35
3'2IF ATGATTTATTGGAGCTCAAAGC 2   
3'2IR GAATTAATACGACTCACTATAGGT N/A 57 15
3'4 TACGGAACAGAGGAGAGATGC 4 60 35
3' -RACE-adapter GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN N/A   N/A
IPCR-out-F AAATCCCACCTTTAGTCCCA 4 60 35
IPCR-in-F CTGCCACCTGAGTGTAGAC 4 60 20
IPCR-ALL-R CACAGGCTTGGAGACTTCC I   
Pthioate-hex NNNNsNsN N/A 30 N/A
Phospho-dT P- GGCCACGCGTCGACTAGTAC(T)18 N/A 55 N/A
GHRL-Real-RT-LK CGACTGGAGCACGAGGACACTGAGCCAGAGAGCGCTTCTAAACTTA N/A N/A  
GHRL-Real-F GCCCCAGCCGACAAGTG N/A 60 40
Ito4-F CATGGAAGTCTCCAAGCCTG I   
Ito4-R CTGCTCTACTGCCTCAATGTC 4 63 34
GHRLOS-Real-RT-LK CGACTGGAGCACGAGGACACTGACAATCCTCCCTGAGGTTGATCT 4 N/A  
GHRLOS-Real-F CATTGAGGCAGTAGAGCAGTTGA 4   
LK CGACTGGAGCACGAGGACACTGA N/A 60 40
Ex4-TaqMan FAM-TGCCGAATGACCACCTACCCTGACTT- BHQ1 4   
18S-Real-F TTCGGAACTGAGGCCATGAT N/A   
18S-Real-R CGAACCTCCGACTTTCGTTCT N/A 60 40
F_CAGE GGGACTGCCTGTAATAGCAC I   
R_CAGEout CACGACTGTTGTACAAGCTC 1 60 35
R_CAGEin GGAGGCGAATAAATGTTCAAACTG 1 61 30
ChiOut-F TGAAAGCCCAGAAGGAGGA N/A   
ChiOut-R TCTAAGTTTAGAAGCGCTCATCTG 1 63 35
ChiIn-F CAGAAGGAGGACGATGTGG N/A   
ChiIn-R CACGACTGTTGTACAAGCTC 1 62 30
UIS231-F ACAAGTTCAACGATGTGGTG N/A   
UIS231-R CAAGTGTGAATAATAACCAAGCCC N/A 55 40
  1. T7 promoter sequence in PCR primers is underlined. Linker sequence (LK) in the primer GHRLOS-Real-RT-LK and GHRL-Real-RT-LK is shown in bold. In primer 3' -RACE-adapter V denotes an A/G/C residue and N denotes A/G/C. Lowercase letters in primer Pthioate-hex denotes phosphothioate linkages. An uppercase P in primer Phospho-dT indicates that the synthetic oligonucleotide was 5' phosphorylated. Annealing temperatures (Ta) of oligonucleotides employed in PCR is shown. The GHRL or GHRLOS exon location of nucleotides are listed, while oligonucleotides spanning synthetic sequences (adapters and linkers) or genes other than GHRL and GHRLOS are denoted as N/A.