Skip to main content

Table 1 PCR primers for chromatin immunoprecipitation assays

From: FIZ1 is part of the regulatory protein complex on active photoreceptor-specific gene promoters in vivo

Gene Positions† Sense primer Anti sense primer bp
Rho -200 to +64 ggggcagacaagatgagacac ttcgtagacagagaccaaggc 264
Pde6b -201 to +56 actgcccataactcctgtaac tgttcctgctgctgtgcccg 257
Rbp3 -28 to +95) cctcacatctaactcccacattg ccttggctcctggataagag 123
Mop -216 to -23 tgagccacccctgtggattg ggaacctgtcagacttggcac 194
Sop -396 to -202 cactcatcctcttcctgtttcc ggtcagtattggtttctgtggc 195
Alb -547 to -82 ggacacaagacttctgaaagtcctc ttcctaccccattacaaaatcata 465
mGluR6 -139 to +67 ccagaggttggctcaggtaag gcaggaaaagttggtgactcg 206
  1. †Relative to the transcriptional start site (+1).
  2. Rho (Rhodopsin), Pde6b (cGMP-dependent phosphodiesterase-beta subunit), Rbp3 (Interphotoreceptor retinoid binding protein), Mop (M-Opsin), Sop (S-Opsin), Alb (Albumin), GluR6 (metabotropic glutamate receptor subtype-6).