Skip to main content

Table 2 Details of primers used for quantitative RT-PCR

From: Selection of internal reference genes for SYBR green qRT-PCR studies of rhesus monkey (Macaca mulatta) tissues

Gene Forward Primer Sequence [5' → 3'] Position in cDNA Reverse Primer Sequence [5' → 3'] Position in cDNA Products Size
GAPDH GAAATCCCATCACCATCTTCCAGG 4th Exon GAGCCCCAGCCTTCTCCATG 5th Exon 120 bp
ACTB CCTGGCACCCAGCACAAT 4th Exon GGGCCGGACTCGTCATAC 5th Exon 144 bp
RPL13A CCTGGAGGAGAAGAGGAAAGAGA 7th Exon TTGAGGACCTCTGTGTATTTGTCAA 8th Exon 126 bp
RPL32 CAACATTGGTTATGGAAGCAACA 3th Exon TGACGTTGTGGACCAGGAACT 3th Exon 80 bp
YWHAZ TCCTTTGCTTGCATCCCAC 6th Exon AAGGCAGACAATGACAGACCA 6th Exon 132 bp
HMBS ACCAAGGAGCTTGAACATGC 5th Exon GAAAGACAACAGCATCATGAG 7th Exon 145 bp
TBP TGCACAGGAGCCAAGAGTGAA 5, 6th Exon CACATCACAGCTCCCCACCA 6th Exon 132 bp
HPRT1 AATTATGGACAGGACTGAACGTCTTGCT 2, 3th Exon TCCAGCAGGTCAGCAAAGAATTTATAGC 3th Exon 117 bp