Skip to main content

Table 2 Assay conditions for each of the nine genes evaluated.

From: Exercise induced stress in horses: Selection of the most stable reference genes for quantitative RT-PCR normalization

Gene symbol Primers 5'-3' (forward, reverse) Amplicon length, bp PCR efficiency, % Correlation with dilution series (R2)
ACTB GGACCTGACGGACTACCTC
CACGCACGATTTCCCTCTC
83 95.2 0.999
B2M CCTGCTCGGGCTACTCTC
CATTCTCTGCTGGGTGACG
89 100.2 1.000
GAPDH ATCTGACCTGCCGCCTGGAG
CGATGCCTGCTTCACCACCTTC
68 102.6 1.000
HPRT AATTATGGACAGGACTGAACGG
ATAATCCAGCAGGTCAGCAAAG
121 93.9 1.000
R18S GTCTGCCCTATCAACTTTCG
TTCCTTGGATGTGGTAGCC
119 94.1 0.998
RPL32 GGGAGCAATAAGAAAACGAAGC
CTTGGAGGAGACATTGTGAGC
138 97.0 1.000
SDHA GAGGAATGGTCTGGAATACTG
GCCTCTGCTCCATAAATCG
91 96.0 0.999
TFRC TGGCTACTTGGGCTATTGTAAACG
GGTGGTTCTGTTCCCTCTATCTCC
90 97.6 0.998
UBB TTCGTGAAGACCCTGACC
CCTTATCCTGGATCTTGGC
91 99.4 0.999