Skip to main content

Table 1 List of Primers and PCR conditions used for 5' RACE

From: Distinct and stage specific nuclear factors regulate the expression of falcipains, Plasmodium falciparum cysteine proteases

Gene Primers Primer sequences 5'-3' PCR conditions
    Denaturation Annealing Extension
Falcipain 1 Fal1RACE GSP1R CAAGATAGGATAGAAGACTTCCTC    
  Fal1RACE GSP2R CATCTTCTTCATTGGAGGATTC 94°C 1' 52°C 1.30' 68°C 1.30'
  Fal1RACE GSP3R CCATGTTGTAATCCATGGTCTTCAAC 94°C 1' 50°C 1.30' 68°C 1.30'
Falcipain 2 Fal2RACE GSP1R TTACCTTAATGGAATGAATGCATC    
  Fal2RACE GSP2R TAGGAAAATAAAATAAAACAAAACCAA 94°C 1' 52°C 1' 68°C 1.30'
  Fal2RACE GSP3R CATGTGGTAATCCATGGTTAAAA 94°C 1' 52°C 1.30' 68°C 1.30'
Falcipain 2a Fal2aRACE GSP1R TTACCTTAATGGAATGAATGCATC    
  Fal2aRACE GSP2R TAGGAAAATAAAATAAAACAAAACCAA 94°C 1' 52°C 1' 68°C 1.30'
  Fal2aRACE GSP3R TATGAATATACATATACACTAGG 94°C 1' 50°C 1.30' 68°C 1.30'
Falcipain 3 Fal3RACE GSP1R TTCAAGTAATGGTACATAAGCTTC    
  Fal3RACE GSP2R CCTAGGATCGTTTATATTATTTGATAA 94°C 1' 52°C 1' 68°C 1.30'
  Fal3RACE GSP3R CATATGATATTCCATGGTTCAAAC 94°C 1' 50°C 1.30' 68°C 1.30'