Identification of valid reference genes for the normalization of RT qPCR gene expression data in human brain tissue

Table 1 Candidate reference genes

Gene Symbol	Gene Name	Cellular Function	TaqMan Assay Number*	Context Sequence
SDHA	Succinate dehydrogenase complex, subunit A	dehydrogenase	Hs00417200_m1	CGCCGCCGTGGTCGAGCTAGAAAAT
UBC	Ubiquitin C	ubiquitination	Hs00824723_m1	CTGTGATCGTCACTTGACAATGCAG
YWHAZ	Tyrosine-3-monooxygenase	signal transduction	Hs00237047_m1	GGAGATAAAAAGAACATCCAGTCAT
RP II	RNA polymerase II polypeptide J	DNA-directed RNA polymerase	Hs00196523_m1	AACATCATTAAATCACAACTCCTAA
HMBS	Hydroxymethylbilane synthase	deaminase	Hs00609297_m1	GCGGCTGCAACGGCGGAAGAAAACA
TBP	TATA box binding protein	transcription factor	Hs99999910_m1	TGGGTTTTCCAGCTAAGTTCTTGGA
B2M	β-2-microglobulin	histocompatibility complex antigen	Hs99999907_m1	AAGTGGGATCGAGACATGTAAGCAG
GAPDH	Glyceraldehyde-3-phosphate dehydrogenase	dehydrogenase	Hs99999905_m1	GGCGCCTGGTCACCAGGGCTGCTTT

* 'm1' suffix denotes cDNA specific assays.
The 'context sequence' is the nucleotide sequence surrounding the region to which the probe binds. The primer and probe sequences for the TaqMan assays are not available. Detailed information for each TaqMan assay is freely available on http://www.appliedbiosystems.com

ISSN: 1471-2199