Skip to main content

Table 1 Candidate reference genes

From: Identification of valid reference genes for the normalization of RT qPCR gene expression data in human brain tissue

Gene Symbol Gene Name Cellular Function TaqMan Assay Number* Context Sequence
SDHA Succinate dehydrogenase complex, subunit A dehydrogenase Hs00417200_m1 CGCCGCCGTGGTCGAGCTAGAAAAT
UBC Ubiquitin C ubiquitination Hs00824723_m1 CTGTGATCGTCACTTGACAATGCAG
YWHAZ Tyrosine-3-monooxygenase signal transduction Hs00237047_m1 GGAGATAAAAAGAACATCCAGTCAT
RP II RNA polymerase II polypeptide J DNA-directed RNA polymerase Hs00196523_m1 AACATCATTAAATCACAACTCCTAA
HMBS Hydroxymethylbilane synthase deaminase Hs00609297_m1 GCGGCTGCAACGGCGGAAGAAAACA
TBP TATA box binding protein transcription factor Hs99999910_m1 TGGGTTTTCCAGCTAAGTTCTTGGA
B2M β-2-microglobulin histocompatibility complex antigen Hs99999907_m1 AAGTGGGATCGAGACATGTAAGCAG
GAPDH Glyceraldehyde-3-phosphate dehydrogenase dehydrogenase Hs99999905_m1 GGCGCCTGGTCACCAGGGCTGCTTT
  1. * 'm1' suffix denotes cDNA specific assays.
  2. The 'context sequence' is the nucleotide sequence surrounding the region to which the probe binds. The primer and probe sequences for the TaqMan assays are not available. Detailed information for each TaqMan assay is freely available on http://www.appliedbiosystems.com