Skip to main content

Table 1 Primers used to amplify target loci

From: Mutation detection using ENDO1: Application to disease diagnostics in humans and TILLING and Eco-TILLING in plants

Targets Primer name Primer sequence
Factor V M13F-FV Forward cacgacgttgtaaaacgac ttaattggttccagcgaaagc
  M13R-FV Reverse ggataacaatttcacacagg tccaataccaacagacctgg
Reverse Trans. M13F-RT Forward cacgacgttgtaaaacgac taggacctacacctgtcaacataa
  M13R-RT Reverse ggataacaatttcacacagg cttctgtatgtcattgacagtcca
RBR exon10-11 RB-1N1 Forward ggagcagtcagaataagcggaatg
  RB-1N1 Reverse taaccaagcccacatcgacgtcatc
  RB-1N2 Forward cacgacgttgtaaaacgac ggctacaattatctcagcagataag
  RB-1N2 Reverse ggataacaatttcacacagg gtcctcttactttccggttgctgaa
RBR exon14-17 RB-2N1 Forward tgaagaagacgccctgtttggcatc
  RB-2N1 Reverse gttgcttaagtgaagaagccgatct
  RB-2N2 Forward cacgacgttgtaaaacgac tgagtgtcttggaaaatgattacga
  RB-2N2 Reverse ggataacaatttcacacagg aggcaaggaaggcacaggaggcaat
BAC F15K9 Tail-At Forward cacgacgttgtaaaacgac gctgattatgggatgatgatatt
  Tail-At Reverse ggataacaatttcacacagg aaaaagcagcgagttataggtttac
  1. Targets: corresponding GenBank accession numbers are Human coagulation factor V (Factor V, Z99573), HIV-1 Reverse Transcriptase (Reverse Trans, AF033819), Pisum sativum Retinoblastoma-related gene RBR (AB012024) and Arabidopsis thaliana BAC F15K9 sequence (AC005278).
  2. Primer sequence: in bold are indicated M13 forward and reverse universal tails; in simple text is indicated the part of the primer specific to the target sequence.
\