Skip to main content

Advertisement

Table 5 Preamplification primers for SSRT-PreAmp

From: Preamplification techniques for real-time RT-PCR analyses of endomyocardial biopsies

Gene 5' sense 3' primer 5' antisense 3' primer
HPRT-CCM GATATAATTGACACTGGCAAAAC ACAAACATGATTCAAATCCCTGA
CD3z CCGATTACAGAGGCACAGAG TCGTACTCCTCTCTTCGTCC
IFNg TTTTGGGTTCTCTTGGCTGTTA CTCTTTTGGATGCTCTGGTCA
FoxP3 CCCAGAGCTCCTACCCACT TGGCACTCAGCTTCTCCTTC
T-bet GACTGGAGGTGTCGGGGAA CCACGTCCACAAACATCCTG
GATA3 TCACAAAATGAACGGACAGAAC TAATATTGTGAAGCTTGTAGTAGA
Granulysin AGGAGCTGGGCCGTGACTA CTCTAGACTGATACCTCCTCA
Perforin TGTGGCCGGCTCACACTCA CGTAGTTGGAGATAAGCCTGA
  1. Sequences of primers used for SSRT-PreAmp of the investigated 8 target genes.