Skip to main content

Advertisement

Table 2 Sequences of primers and probes of self-designed real-time RT-PCR gene assays

From: Preamplification techniques for real-time RT-PCR analyses of endomyocardial biopsies

Gene name 5' sense 3' primer sequence 5' antisense 3' primer sequence
TRBC TCCGCTGTCAAGTCCAGTTCTA GACAGGACCCCTTGCTGGTA
TRBV common antisense primer   CTGCTTCTGATGGCTCAAACA
TRBV2 ACTCTGAAGATCCGGTCCACAA  
TRBV3 ATCAATTCCCTGGAGCTTGGT  
TRBV4 CCTGAATGCCCCAACAGC  
TRBV5 GCTCTGAGCTGAATGTGAACGC  
TRBV5WBL GCTCTGAGATGAATGTGAGTGC  
TRBV6 CACTGACAAAGGAGAAGTCCC  
TRBV6WBL6-2 AACTGCCAAAGGAGAGGTCCC  
TRBV6WBL6-4 CACTGGCAAAGGAGAAGTCCC  
TRBV7 CTCTCAGGTGTGATCCAATTTCG  
TRBV7WBL7-2;7-3 AGCTCAGGTGTGATCCAATTTCA  
TRBV7WBL7-9 CTTTCAGGTGTGATCCAATTTCT  
TRBV9 CACAACAGTTCCCTGACTTGCA  
TRBV10 CATGGGCTGAGGCTGATC  
TRBV11 CTGCAGAGAGGCTCAAAGGAGTAG  
TRBV12 AGAACCCAGGGACTCAGCTGT  
TRBV13 GAACTGAACATGAGCTCCTTGGA  
TRBV14 CTGAAAGGACTGGAGGGACGTAT  
TRBV15 CAGGAGGCCGAACACTTCTTT  
TRBV16 GCCTCCCAAATTCACCCTGTA  
TRBV18 CCAGCATCCTGAGGATCCA  
TRBV19 ACTGTGACATCGGCCCAAA  
TRBV20 AACCATGCAAGCCTGACCTT  
TRBV23 CCCTGCAGCCTGGCAAT  
TRBV24 GCTAAATTCTCCCTGTCCCTAGAGT  
TRBV25 TTCCCCTGACCCTGGAGTCT  
TRBV27 GGCTTAAGGCAGATCTACTATTCAATG  
TRBV28 GCCAGCACCAACCAGACAT  
TRBV29 AGCCGCCCAAACCTAACATT  
TRBV30 CGGCAGTTCATCCTGAGTTCT  
HPRT-CCM AGTCTGGCTTATATCCAACACTTCG GACTTTGCTTTCCTTGGTCAGG
IL10 CAAGTTGTCCAGCTGCTTCAT TTGGCGAAAGCAGCTCCTC
IFNγ CAGGTCATTCAGATGTAGCGGATAA AGGAGACAATTTGGCTCTGCATT
TGFβ CCCTGCCCCTACATTGGAG CCGGTTATGCTGGTTGTACA
FoxP3 TGGCAAACGGAGTCTGCAA TCTCATCCAAGAGGTGATCTGCTT
T-bet CAACACAGGAGGCGCACTGG CCCCCTTGTTGTTTGTGAGCT
GATA3 CCTCATTAAGCCCAAGCGAAG TTGGCATTTCCTCCAGAGT
GRAIL GAAGCAGAGGCAATTAAAGGCAG CATCAGGGCCAATTTCCTTGT
Granzyme A CCCTGTGATTGGAATGAATATGGT ACACCCTCGCACAACAAAGG
Granzyme B GCGAATCTGACTTACGCCATTATT CAAGAGGGCCTCCAGAGTCC
Granulysin AAAACTGAAGAAGATGGTGGATAAGC ATCGTGACCTCCCCGTCCTA
Perforin GGACCAGTACAGCTTCAGCACTG AGTCAGGGTGCAGCGGG
  1. Sequences of primers of self-designed real-time RT-PCR gene assays. For the different TRBV forward primers, one common reverse primer and one common MGB hybridization probe was designed. Wobbled (WBL) forward primers were used for TRBV5, 6 and 7.