Skip to main content

Table 2 Sequences of primers and probes of self-designed real-time RT-PCR gene assays

From: Preamplification techniques for real-time RT-PCR analyses of endomyocardial biopsies

Gene name 5' sense 3' primer sequence 5' antisense 3' primer sequence
TRBV common antisense primer   CTGCTTCTGATGGCTCAAACA
  1. Sequences of primers of self-designed real-time RT-PCR gene assays. For the different TRBV forward primers, one common reverse primer and one common MGB hybridization probe was designed. Wobbled (WBL) forward primers were used for TRBV5, 6 and 7.