Skip to main content

Table 2 Oligonucleotides

From: Expression of yeast lipid phosphatase Sac1p is regulated by phosphatidylinositol-4-phosphate

Primer Sequence
Sac1(-500)fwd TTGCGGCCGC ACAGCTACCACATCCCTGAC
Sac1(-242)fwd TTGCGGCCGC CCAAGCCTCGCTCCTATTGT
Sac1(-170)fwd TTGCGGCCGC CTGCACTACTGCTTACCCACA
Sac1(-125)fwd TTGCGGCCGC GAAGTTGAAAAGGCAAGGGA
Sac1(-114)fwd TTGCGGCCGC GGCAAGGGAAAAATACCACA
Sac1(-100)fwd TTGCGGCCGC ACCACAGGTTTAGATAAGGA
Sac1(-83)fwd TTGCGGCCGC GGAAATAGGAGAAAGGATTAG
Sac1(-1)rev GGCTCGAG ATCTAGACGAGAAAATATACG
Sac1(-150)rev GGCTCGAG TGTGGGTAAGCAGTAGTGCAG
Sac1Δ(-100/-84)fwd GAAAAGGCAAGGGAAAAATGGAAATAGGAGAAAGG
Sac1Δ(-100/-84)rev CCTTTCTCCTATTTCCATTTTTCCCTTGCCTTTTC
Sac1Δ(-83/-70)fwd CCACAGGTTTAGATAAGGATTAGAAACCATATCC
Sac1Δ(-83/-70)rev GGATATGGTTTCTAATCCTTATCTAAACCTGTGG
Sac1Δ(-91/-84)fwd GGGAAAAATACCACAGGTGGAAATAGGAGAAAGG
Sac1Δ(-91/-84)rev CCTTTCTCCTATTTCCACCTGTGGTATTTTTCCC
Sac1Δ(-100/-92)fwd GGCAAGGGAAAAATATTAGATAAGGAAATAGG
Sac1Δ(-100/-92)rev CCTATTTCCTTATCTAATATTTTTCCCTTGCC
Opi1KOfwd CATATCAGGCCAGAACGTGGCATTTTGTTTACAGTGCTGAAGATTGTACTGCTGAGAGTGCAC
Opi1KOrev AACTATATTATTCCGTATAATATTATTACTGGTGGTAATGCTGTGCGGTATTTCACACCG