Skip to main content

Advertisement

Table 2 Sequences of single-stranded oligonucleotides binding at the hprt coding strand

From: Simultaneous targeted exchange of two nucleotides by single-stranded oligonucleotides clusters within a region of about fourteen nucleotides

Oligonucleotide Sequence
Oligonucleotides with a first mismatch at position 153 and a second mismatch at position 147 in different distances to the 3'-end
C47-153-147 5'-TATATCCCCATATA CCCATCTCTTTCATGACATCG CAGGCG AGTCTT-3'
C53-153-147 5'-TATATCCCCATATA CCCATCTCTTTCATGACATCG CAGGCG AGTCTTTCAGTC-3'
C59-153-147 5'-TATATCCCCATATA CCCATCTCTTTCATGACATCG CAGGCG AGTCTTTCAGTCCTACAA-3'
C65-153-147 5'-TATATCCCCATATA CCCATCTCTTTCATGACATCG CAGGCG AGTCTTTCAGTCCTACAAAAATAG-3'
C71-153-147 5'-TATATCCCCATATA CCCATCTCTTTCATGACATCG CAGGCG AGTCTTTCAGTCCTACAAAAATAGAATCAC-3'
Oligonucleotides with a first mismatch at position 151 and a second mismatch in various distance to the first
H1-151 5'-TATATCCCCATATA CCCATCTCTTTCATGACATCTCG GGCAAGTCTTTCAGTCCTACAA-3'
H7-151-141 5'-TATATCCCCATATA CCCATCTCTTTCATGACATCTCG GGCAAGTCTC TCAGTCCTACAA-3'
H5-151-144 5'-TATATCCCCATATA CCCATCTCTTTCATGACATCTCG GGCAAGC CTTTCAGTCCTACAA-3'
H3-151-147 5'-TATATCCCCATATA CCCATCTCTTTCATGACATCTCG GGCG AGTCTTTCAGTCCTACAA-3'
H2-151-150 5'-TATATCCCCATATA CCCATCTCTTTCATGACATCTCGA GCAAGTCTTTCAGTCCTACAA-3'
H4-151-156 5'-TATATCCCCATATA CCCATCTCTTTCATGACG TCTCG GGCAAGTCTTTCAGTCCTACAA-3'
H6-151-159 5'-TATATCCCCATATA CCCATCTCTTTCATA ACATCTCG GGCAAGTCTTTCAGTCCTACAA-3'
H8-151-165 5'-TATATCCCCATATA CCCATCTCC TTCATGACATCTCG GGCAAGTCTTTCAGTCCTACAA-3'
H9-151-168 5'-TATATCCCCATATA CCCATT TCTTTCATGACATCTCG GGCAAGTCTTTCAGTCCTACAA-3'
Oligonucleotides with a first mismatch at position 153 and a second mismatch in various distance to the first
H153-1T 5'-TATATCCCCATATA CCCATCTCTTTCATGACATCG CAGGCAAGTCTTTCAGTCCTACAA-3'
C153-147 5'-TATATCCCCATATA CCCATCTCTTTCATGACATCG CAGGCG AGTCTTTCAGTCCTACAA-3'
C153-150 5'-TATATCCCCATATA CCCATCTCTTTCATGACATCG CAA GCAAGTCTTTCAGTCCTACAA-3'
C153-156 5'-TATATCCCCATATA CCCATCTCTTTCATGACG TCG CAGGCAAGTCTTTCAGTCCTACAA-3'
C153-159 5'-TATATCCCCATATA CCCATCTCTTTCATA ACATCG CAGGCAAGTCTTTCAGTCCTACAA-3'
Oligonucleotides with a first mismatch at position 151 and a second mismatch in various distance to the first
O45-151-147 5'-C*C*C*A*TCTCTTTCATGACATCTCG GGCG AGTCTTTCAGTCCT*A*C*A*A-3'
O45-151-150 5'-C*C*C*A*TCTCTTTCATGACATCTCGA GCAAGTCTTTCAGTCCT*A*C*A*A-3'
O42-151-156 5'-T*C*C*C*ATCTCTTTCATGACG TCTCG GGCAAGTCTTTCAG*T*C*C*T-3'
O45-151-159 5'-C*C*C*A*TCTCTTTCATA ACATCTCG GGCAAGTCTTTCAGTCCT*A*C*A*A-3'
Oligonucleotides in different length with a first mismatch at position 151 and a second mismatch at position 159
O-25-151C-159T 5'-T*T*T*C*ATA ACATCTCG GGCAAG*T*C*T*T-3'
O-30-151C-159T 5'-C*T*C*T*T TCATA ACATCTCG GGCAAGTC*T*T*T*C-3'
O-45-151C-159T 5'-C*C*C*A*TCTCTTTCATA ACATCTCG GGCAAGTCTTTCAGTCCT*A*C*A*A-3'
O-48-151C-159T 5'-C*C*T*C*CCATCTCTTTCATA ACATCTCG GGCAAGTCTTTCAGTCCT*A*C*A*A-3'
  1. The 5' TA-clamps are indicated in italics and the phosphorothioates are indicated by asterisks. The positions of the first and second mismatch are indicated in bold and underlined.