Skip to main content

Advertisement

Table 1 Genes selected for expression analysis

From: Characterization of housekeeping genes in zebrafish: male-female differences and effects of tissue type, developmental stage and chemical treatment

Gene Name Gene Symbol Cellular Function Primer Sequence (5'-3') Reference Accession #
bactin1 bactin1 Cytoskeleton F) CGAGCAGGAGATGGGAACC 14 AF057040
    R) CAACGGAAACGCTCATTGC   
tubulin, alpha 1 tuba1 Cytoskeleton F) CCTGCTGGGAACTGTATTGT * AF029250
    R) TCAATGAGTTCCTTGCCAAT   
glyceraldehyde-3-phosphate dehydrogenase gapdh Glycolysis enzyme F) GTGGAGTCTACTGGTGTCTTC 15 BC083506
    R) GTGCAGGAGGCATTGCTTACA   
glucose-6-phosphate dehydrogenase g6pd Glycolysis enzyme F) GTCCCGAAAGGCTCCACTC 9 BM182602
    R) CCTCCGCTTTCCTCTC   
TATA-box-binding protein tbp Transcription F) CGGTGGATCCTGCGAATTA * NM_200096
    R) TGACAGGTTATGAAGCAAAACAACA   
beta-2-microglobulin b2m Major histocompatibility complex F) GCCTTCACCCCAGAGAAAGG * BC062841
    R) GCGGTTGGGATTTACATGTTG   
elongation factor 1-alpha elfa Translation F) CTTCTCAGGCTGACTGTGC 16 AY422992
    R) CCGCTAGCATTACCCTCC   
18s ribosomal RNA 18s Ribosome subunit F) TCGCTAGTTGGCATCGTTTATG 17 BX296557
    R) CGGAGGTTCGAAGACGATCA   
cytochrome P450, family 19, subfamily A, polypeptide 1b cyp19a1b Steroid biosynthesis F) AAAGAGTTACTAATAAAGATCCACCGGTAT 13 AF226619
    R) TCCACAAGCTTTCCCATTTCA   
cytochrome P450, family 1, subfamily A cyp1a Xenobiotic metabolism F) GCATTACGATACGTTCGATAAGGAC 18 NM_131879
    R) GCTCCGAATAGGTCATTGACGAT   
  1. The first 8 were candidate housekeeping genes. cyp19a1b and cyp1a, targets of ER and AhR mediated signal transduction, respectively, were used to tests effects of normalization on apparent gene expression. Asterisks (*) indicate primers designed in this study.