Skip to main content

Table 2 Oligonucleotide primers used for RT-PCR analysis

From: Expression and characterization of novel ovine orthologs of bovine placental prolactin-related proteins

Gene Primer Sequence Position
oPRP1 Forward 5' AACCCATGCCCGTCCTGCGGT 3' 157–177
(AB231297) Reverse 5' TTAGCACGTTTTGAGGGCTCG 3' 714–694
oPRP2 Forward 5' AACTCATGCCCATCCTGCAGT 3' 155–175
(AB231298) Reverse 5' TTAGCACGTTTTGCGGATTCG 3' 763–743
oGAPDH Forward 5' AAGGCCATCACCATCTTCCA 3' 78–97
(AF030943) Reverse 5' AGGTCAGATCCACAACGGACA 3' 603–583