Skip to main content

Table 1 Primers for PCR and sequencing

From: Construction and evaluation of multisite recombinatorial (Gateway) cloning vectors for Gram-positive bacteria

Gateway primers Sequence (5-3') Use
Term attB2F GGGGACAGCTTTCTTGTACAAAGTGGAAATCAGAACGCAGAAGCGGTC Amplification of terminator
Term attB3R GGGGACAACTTTGTATAATAAGTTGTTTAAACTGGCAGTTTATGGCGGGC Amplification of terminator
Lux E attB2R GGGGACCACTTTGTACAAGAAAGCTGGGTTCAACTATCAAACGCTTCGG Amplification of lux reporter
GFP attB2R GGGGACCACTTTGTACAAGAAAGCTGGGTGACACATTTATTTGTATAGTTC Amplification of gfp reporter
GFPopt attB1F GGGGACAAGTTTGTACAAAAAAGCAGGCTAGGAGGAATAAAAAATGAGTAAAGGCGAAGAAC Amplification of gfp reporter
XylRA attB4F GGGGACAACTTTGTATAGAAAAGTTGCGTTGACTTAACTAACTTATAG Amplification of xylR P xylA
XylRA attB1R GGGGACTGCTTTTTTGTACAAACTTGTTGA TTTAAGTGAACAAGTTTATC Amplification of xylR P xylA
XylA attB4F GGGGACAACTTTGTATAGAAAAGTTGAAACATTGAAATAAACATTTATTTTGTATATGATG Amplification of P xylA
XylA attB1R GGGGACTGCTTTTTTGTACAAACTTGTTGATTTAAGTGAACAAGTTTATC Amplification of P xylA
LuxA attB1F GGGGACAAGTTTGTACAAAAAAGCAGGCTAGGAGGACTCTCTATGAAATTTGGAAAC Amplification of lux reporter
SASP attB4F GGG GAC AAC TTT GTA TAG AAA AGT TGT TTA AAC GCT GGA ACC TTT TGT TCC CAA AAG Amplification of P sspA
SASP attB1R GGG GAC TGC TTT TTT GTA CAA ACT TGT TTT ATT TAG TAT GGT TGG GTT AAC TGG Amplification of P sspA
attR3 GGGGCGTTTAAACAAGCTTGTAAAACGACGGCCAGTG sequencing
PMEattR4 GGGTTTAAACAACTTTGTATAGAAAAGTTGAACGAG sequencing
Ccdb Rev AGGAAGGGATGGCTGAGGTC sequencing
Cm R4-R3F CAGGCGGGCAAGAATGTGA sequencing