Skip to main content

Table 1 Oligonucleotides used in gel shift assays *

From: GATA elements control repression of cardiac troponin I promoter activity in skeletal muscle cells

cTnI GATA# 5' CGCCTGTTATCGCTTATCCTGGG 3'
GCGGACAATAG CGAATAG GACCC
cTnI mut GATA → CACA 5' CGCCTGTTG TG GCTTG TG CTGGG 3'
GCGGACAA C A C CGAA C A C GACCC
cTnI mut GATA → GCCA 5' CGCCTGTTGG CGCTTGG CCTGGG 3'
GCGGACAA CC G CGAA CC G GACCC
BNP GATA 5'GATCCCAGGAATGTGTCTGATA AATCAGAGATA ACCCA 3'
  1. * GATA sites are underlined. Mutated nucleotides are indicated in bold.
  2. # This sequence comprises the two GATA elements closely associated between -67 and -57 of the cTnI promoter