Skip to main content

Table 1 Sequence of HIV-1 TAR, TAR mutants, oligonucleotides used to generate RPA probes, and synthetic siRNA

From: HIV-1 TAR element is processed by Dicer to yield a viral micro-RNA involved in chromatin remodeling of the viral LTR

Name Sequence
TAR-WT GGUCUCUCUGGUUAGACCAG AUCUGAGCCUGGGAGCUCUCUGGCUAACUAGGGAACC
TAR-A GCA CAGGGAUCAAUC AGGUCU UCUCUCGC UGGGACGAGAGACCGAUUGGUCUCUUG C
TAR-B GGUCUCUCUGGUUAGACCAGA___GAGCCUGGGAGCUCUCUGGCUAACUAGGGAACC
TAR-C GGUCUCUCUGGUUAGACCAGAUCUGAGCCU___AGCUCUCUGGCUAACUAGGGAACC
TAR-D GG______________CCAGAUCUGAGCCUGGGAGCUCUCUGG____________CC
TAR-E GGUCUCUCUGGUUAGACCAGAUCUGAGCCUGGGAGCUCUCUGGCUA___________
T7 Primer TAATACGACTCACTATAGGGAGA
TAR 5' Template GGTCTCTCTGGTTAGACCAGATCTGATTTTTTCTCCCTATAGTGAGTCGTATTA
TAR 3' Template AGCTCTCTGGCTAACTAGGGAACCCACTTTTTTCTCCCTATAGTGAGTCGTATTA
siGL2 5' CGUACGCGGAAUACUUCGAUU 3'
3' UUGGAUGCGCCUUAUGAAGCU 5'
siGFP 5' GCGACGUAAACGGCCACAAGUUCUC 3'
3' GCCGCUGCAUUUGCCGGUGUUCAAG 5'
siTAR1 5' UGGGUCUCUCUGGUUAGACCAGUU 3'
3' UUACCCAGAGAGACCAAUCUGGUC-P 5'
siTAR2 5' CUCUCUGGCUAACUAGGGAACCUU 3'
3' UUGAGAGACCGAUUGAUCCCUUGG-P 5'
LTR forward CGAGCTTGCTACAAGGGACT
LTR reverse GAGATTTTCCACACTGACTAAAAGG
Luc forward TGAACTTCCCGCCGCCGTTGT
Luc reverse TTACAATTTGAACTTTCCGCC
DicerRT F TTTGTGCAGTTTCAGCTTGA
DicerRT R CCATGGCCTTTGGAACTTC