Skip to main content

Table 2 Characteristics of gene-specific real-time PCR assays

From: In search of suitable reference genes for gene expression studies of human renal cell carcinoma by real-time PCR

Gene symbol Gene name Accession No. Primer/Probe Sequence [5'→3'] Amplicon Size [bp] Detection Dye/Probe PCR Efficiencyd
ACTB Actin, beta NM_001101 Forward: agcctcgcctttgccga
Reverse: ctggtgcctggggcg
Probe: F-ccgccgcccgtccacacccgccT-P
174 TMa 1.89
ALAS1 5-Aminolevulinate delta-, synthase 1 NM_000688 LightCycler-h-ALAS
Housekeeping Gene Set
Roche (Cat. No. 03 302 504 001)
127 Hybb 1.97
GAPDH Glyceraldehyde-3-phosphate dehydrogenase NM_002046 Forward: gaaggtgaaggtcggagtc
Reverse: gaagatggtgatgggatttc
Probe: F-caagcttcccgttctcagccT-P
226 TM 1.99
HMBS Hydroxymethyl-bilane synthase Alias: Porphobilinogen deaminase (PBGD) NM_000190 LightCycler-h-PBGD
Housekeeping Gene Set
Roche, Cat. No. 03 146 073 001
150 Hyb 1.98
HPRT1 Hypoxanthine phosphoribosyl transferase 1 NM_000194 LightCycler-h-HPRT
Housekeeping Gene Set
Roche (Cat. No. 03 261 891 001)
181 Hyb 2.00
PPIA Peptidylprolyl isomerase A
Alias: Cyclophilin A
NM_021130 Hs_PPIA_1_SG QuantiTect Primer Assay
Qiagen (Cat. No. QT00052311)
121 SGIc 1.84
RPLPO Ribosomal protein, large, PO NM_001002 Hs_RPLPO_1_SG QuantiTect Primer Assay
Qiagen (Cat. No. QT00075012)
79 SGI 1.92
SDHA Succinate dehydrogenase complex,
subunit A, flavoprotein (Fp)
NM_004168 Forward: cactggaggaagcacaccc
Reverse: ccttcccagtgccaacgtccacaat
Probe: F-ccttcccagtgccaacgtccacaaT-P
78 TM 1.92
TBP TATA box binding protein NM_003194 Forward: ttcggagagttctgggattgta
Reverse: tggactgttcttcactcttggc
Probe: F-ccgtggttcgtggctctcttatcctcaT-P
227 TM 1.88
TUBB Tubulin, beta NM_178014 Hs_TUBB_1_SG QuantiTect Primer Assay
Qiagen (Cat. No. QT00089775)
120 SGI 1.98
ADAM9 ADAM metallopeptidase domain 9,
(meltrin gamma)
NM_003816 Forward: ggtgacagatttggcaattgtg
Reverse: ttgtgccttcgttaaccatcc
Donor probe:
acgcctagtcgaggcaccaaatgttg-6Fl
Acceptor probe:
Cy5.5-gtgtggatttccagctaggatcagatgttcc-P
226 Hyb 1.95
  1. aTM = TaqMan probes are 3'-end F, FAM (6-carboxy-fluorescein) and near 5'-end T, TAMRA (6-carboxy-tetramethyl-rhodamine) labelled and P, phosphorylated
  2. bHyb = Hybridization probes, two different labelled probes are included in the kit (Roche); for target gene see text
  3. cSGI = SYBR® Green I fluorescent dye
  4. dPCR efficiencies were calculated according to Rasmussen [2].