In search of suitable reference genes for gene expression studies of human renal cell carcinoma by real-time PCR

Jung, Monika; Ramankulov, Azizbek; Roigas, Jan; Johannsen, Manfred; Ringsdorf, Martin; Kristiansen, Glen; Jung, Klaus

doi:10.1186/1471-2199-8-47

BMC Molecular Biology

Table 2 Characteristics of gene-specific real-time PCR assays

From: In search of suitable reference genes for gene expression studies of human renal cell carcinoma by real-time PCR

Gene symbol	Gene name	Accession No.	Primer/Probe Sequence [5'→3']	Amplicon Size [bp]	Detection Dye/Probe	PCR Efficiency^d
ACTB	Actin, beta	NM_001101	Forward: agcctcgcctttgccga Reverse: ctggtgcctggggcg Probe: F-ccgccgcccgtccacacccgccT-P	174	TM^a	1.89
ALAS1	5-Aminolevulinate delta-, synthase 1	NM_000688	LightCycler-h-ALAS Housekeeping Gene Set Roche (Cat. No. 03 302 504 001)	127	Hyb^b	1.97
GAPDH	Glyceraldehyde-3-phosphate dehydrogenase	NM_002046	Forward: gaaggtgaaggtcggagtc Reverse: gaagatggtgatgggatttc Probe: F-caagcttcccgttctcagccT-P	226	TM	1.99
HMBS	Hydroxymethyl-bilane synthase Alias: Porphobilinogen deaminase (PBGD)	NM_000190	LightCycler-h-PBGD Housekeeping Gene Set Roche, Cat. No. 03 146 073 001	150	Hyb	1.98
HPRT1	Hypoxanthine phosphoribosyl transferase 1	NM_000194	LightCycler-h-HPRT Housekeeping Gene Set Roche (Cat. No. 03 261 891 001)	181	Hyb	2.00
PPIA	Peptidylprolyl isomerase A Alias: Cyclophilin A	NM_021130	Hs_PPIA_1_SG QuantiTect Primer Assay Qiagen (Cat. No. QT00052311)	121	SGI^c	1.84
RPLPO	Ribosomal protein, large, PO	NM_001002	Hs_RPLPO_1_SG QuantiTect Primer Assay Qiagen (Cat. No. QT00075012)	79	SGI	1.92
SDHA	Succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	NM_004168	Forward: cactggaggaagcacaccc Reverse: ccttcccagtgccaacgtccacaat Probe: F-ccttcccagtgccaacgtccacaaT-P	78	TM	1.92
TBP	TATA box binding protein	NM_003194	Forward: ttcggagagttctgggattgta Reverse: tggactgttcttcactcttggc Probe: F-ccgtggttcgtggctctcttatcctcaT-P	227	TM	1.88
TUBB	Tubulin, beta	NM_178014	Hs_TUBB_1_SG QuantiTect Primer Assay Qiagen (Cat. No. QT00089775)	120	SGI	1.98
ADAM9	ADAM metallopeptidase domain 9, (meltrin gamma)	NM_003816	Forward: ggtgacagatttggcaattgtg Reverse: ttgtgccttcgttaaccatcc Donor probe: acgcctagtcgaggcaccaaatgttg-6Fl Acceptor probe: Cy5.5-gtgtggatttccagctaggatcagatgttcc-P	226	Hyb	1.95

^aTM = TaqMan probes are 3'-end F, FAM (6-carboxy-fluorescein) and near 5'-end T, TAMRA (6-carboxy-tetramethyl-rhodamine) labelled and P, phosphorylated
^bHyb = Hybridization probes, two different labelled probes are included in the kit (Roche); for target gene see text
^cSGI = SYBR^® Green I fluorescent dye
^dPCR efficiencies were calculated according to Rasmussen [2].

Back to article page

ISSN: 1471-2199

Contact us

General enquiries: ORSupport@springernature.com