Skip to main content

Table 3 Primers used in the PCR experiments

From: Duplication of the dystroglycan gene in most branches of teleost fish

Fish Primer Sequence primer (5'-3')
D. rerio DAG1_s CCAGCCTTTCATCTGTGGCAA
D. rerio DAG1_as CTTCGCACCCTTTTGGGCAC
D. rerio ACT_s TCTTGACCCTGAAGTACCCCATT
D. rerio ACT_as TCCTTGATGTCGCGCACAAT
D. labrax FISH_ext_s GGGCTTCAGCACATGAAGAT
D. labrax FISH_ext_as CTGTAGGG(A/G)GTCATGTTCTT
D. labrax ACT s TCCTGACCCTGAAGTACCCCA
D. labrax ACT as TTGATGTCACGCACGATTTCC
T. nigroviridis DAG1a s CAGACGTTCCTGTGTGAGGGG
T. nigroviridis DAG1a as GCTTCGGAAGGTGCTGCTTC
T. nigroviridis DAG1b s AGCTCAGCCTCTCACCTGTAGC
T. nigroviridis DAG1b as GACTCGTTTCACTCCATGGACC
T. nigroviridis ACT s CACCCTGAAGTATCCCATCGAA
T. nigroviridis ACT as GTCTCTGACGATCTCTCGCTCAG
  1. The primers used to amplify the gene sequences from D. rerio and T. nigroviridis were designed using the sequences available in the database. The degenerate primers FISH_ext_s and FISH_ext_as, which allowed the fishing of the newly identified D. labrax sequence, were chosen exploiting two regions displaying very high homology within the aligned DG sequences from D. rerio and T. rubripes (see also Fig. 1).