Skip to main content

Advertisement

Table 2 Oligonucleotide primers designed for RACE-PCR and for the selection of positive clones

From: Selection strategy and the design of hybrid oligonucleotide primers for RACE-PCR: cloning a family of toxin-like sequences from Agelena orientalis

Primer name Primer sequence
URA_L* CTGCAGATCTAGAAGCTTTTTTTTTTTTTT
URA_N GGAATTCTGCAGATCTAGAAG
URA_T GGAATTCTGCAGATCTA
OLIGO-dT-21** TTT TTT TTT TTT TTT TTT TTT
OLIGO-dT-24 TTT TTT TTT TTT TTT TTT TTT TTT
OLIGO-dT-27 TTT TTT TTT TTT TTT TTT TTT TTT TTT
hGAP-F62*** AGCCAAAAGGGTCATCATCT
hGAP-R62 GCCTGCTTCACCACCTTC
pBS-F**** GGTTTTCCCAGTCACGA
pGM-2R ATGCTTCCGGCTCGTATGT
  1. * URA (all primers) – RACE-PCR primers;
  2. ** OLIGO-dT (all primers) are for RACE-PCR, OLIGO-dT-21 was also used for cDNAs synthesis;
  3. *** hGAP (both primers) – for positive controls (with mouse cDNA);
  4. **** pBS-F and pGM-2R designed for the selection of positive clones from bacterial colonies.