Skip to main content

Table 1 Sequences of primers used for the constructs and the LightCycler

From: Deletion of the cruciform binding domain in CBP/14-3-3 displays reduced origin binding and initiation of DNA replication in budding yeast

Primers Sequences
α5-helix deletion  
Fragment 1-F 5' CGGAATTCATGGATGATCCGAGAGGATCTG 3'
Fragment 2-F 5' GCTCTAGATCACTGATTTTCGTCTTCCAC 3'
Fragment 1-R 5' CGCCTTGGACTCGCCAGTGTTAGCTGC 3'
Fragment 2-R 5' GCCCAAGGCCACAGGAAACGACAGGAAGG 3'
PCR of ARS307  
ARS307-F 5' ATATTGCAATTACTTCTTCTCATGCAC 3'
ARS307-R 5' ATATTGCAATTACTTCTTCTCATGCAC 3'
PARS307-F 5' GGTAGGGATAATAATCTGTAATGAGGA 3'
PARS307-R 5' TATGTCGACGAGTGAGTTGGA 3'
Real-Time PCR  
RT-ARS307-F 5' GCAGTAGCACATGGACACATTCAC 3'
RT-ARS307-R 5' AGGGTTTCTGGAGAGGTAGGGATA 3'
NegARS307-F 5' ATTTTGTGGTGGATTGGAG 3'
NegARS307-R 5' GCTTGTTTGTGCAACTAAACG 3'
ARS1-F 5' GAAAATAGGTTATTACTGAGTAG 3'
ARS1-R 5' CCTGCGATGTATATTTTCCTG 3'
R2.5-F 5' CATCAATTGTGCACTCGGAC 3'
R2.5-R 5' GAACACGGCAATTGTAGGTGG 3'