Skip to main content

Table 3 Gene specific primers for 5' RLM-RACE reactions

From: Core histone genes of Giardia intestinalis: genomic organization, promoter structure, and expression

Primers 5' to 3' sequence
H2A/outer CCCTCTCTTCCCTCCTT
H2A/inner AGGGCAGTTAGGATGTGGTT
H2B/outer ACTTCTTCGTGGACTCCTTC
H2B/inner CGTGTTCCGCTTGCTGAT
H3/outer GAAGAGCGAGATGATGTAGTTC
H3/inner CTGGAAGCGGATGTCGGA
H4/inner ATGGCGGGCTTCGTGAT
H4/outer TCCCGAATCCATAGAGTGTGC