Skip to main content

Table 1 Primer sequences used in this study.

From: Sp1/Sp3 and DNA-methylation contribute to basal transcriptional activation of human podoplanin in MG63 versus Saos-2 osteoblastic cells

Name Sequence (5'→3') a Experiment b
hPP rev (+207/+178) CACATCGTTCCCGTTGAGTTGTTGCTCTCC RT-PCR
hPP 1 (+1/+19) AACTGCAAAGTTTGCTGTC RT-PCR
hPP 2 (-16/+3) CGCTCGGAAAGTTCTCAAC RT-PCR
hPP 3 (-35/-17) GAGAGATAAATGCTGACTC RT-PCR
hPP 4 (-52/-33) CTCCCCCGCCTCCTCGGGA RT-PCR
hPP 5 (-68/-50) CTTGCGGCCGACCCCGCTC RT-PCR
hPP 6 (-83/-65) CCGGACGGAGACCACCTTG RT-PCR
hPP 7 (-97/-79) CGGGCCTAGCGCGCCCGGA RT-PCR
hPP 8 (-108/-90) GAGCCCGAGGGCGGGCCTA RT-PCR
hPP 9 (-125/-107) TTGGCGCCGGCCAAACAGA RT-PCR
hPP rev (+114/+96) AGCCTGGAGGAGCGCGAC RT-PCR
FII (-1885/-1866) GCAATGAGCTCATCCACTAACTCCTTCATCC Cloning, LA
F I (-857/-840) GCAATGAGCTCACGTAAGTTCTCTGGTTG Cloning, LA
RII (-783/-803) GCAATCTCGAGAATCCTCACTTTACTGGTTTA Cloning
RI (+154/+171) GCAATCTCGAGCCGAGCAGCAAGATTCTG Cloning, LA
F1 (-1642/-1616) TTGAATAAAGCGGGCCATC LA
F2 (-1378/-1360) TCATCTTCTAGGTTCAGGT LA
F3 (-1104/-1086) ACAATCTCTCCTGTGATTC LA
F4 (-666/-658) ACAGCATCGCAGCGCTGGA LA
F5 (-498/480) ACCAGCGCGGGCCGCCTCT LA
F6 (-361/-343) CACTTCTGCCCATAACAAG LA
F7 (-261/-243) AACCCCGTTTGTTGCATGT LA
F8 (-232/-214) CCTCCTGTTGTTGAGCAGA LA
F9 (-186/-168) AGTCCTGGCGGCCCCCGCA LA
F10 (-159/-141) CCTGTAACTTTAAACCTGG LA
F11 (-114/-96) CAAACAGAGCCCGAGGGCG LA
F12 (-76/-58) GAGACCACCTTGCGGCCGA LA
F13 (-38/-20) CGGGAGAGATAAATGCTGA LA
F14 (-26/-8) ATGCTGACTCCGCTCGGAA LA
fp 1 CCGCTCCCCCGCCTCCT CGGGA EMSA
fp 1 mut CCGCTCCA CATAA TCCTCGGGA Mutation
fp 2 GAGCCCGAGGGCGGG CCTAGCG EMSA
fp 2 mut GAGCCCGAT GATAA GCCTAGCG Mutation
fp 3 GATCATCGTTTTGGCGCCGGC CAA EMSA
fp 4 CAGATGACGGCCAACTTTTTTTGTTTTTAAGCCATCAAA EMSA
fp 5 CCAAACTCCCCCCACC AGCCAG EMSA
fp 5 mut CCAAACTCTA CAG ACCAGCCAG Mutation
fp 6 TTTTCAAAACTGCCAAAGCC EMSA
fp 7 CACCGCTTGGCCCGGCCTAATCC EMSA
fp 7 mut CACCGCTTGGAT CTTG CCTAATCC Mutation
fp 8 GGACACAGGTTTGCGACCAGGACGGT EMSA
Bis-fwd 1 GTTAGGGTTTGTAGTTTTGGTGG BS
Bis-rev 1 CACCACAACCACAAACCCAACCT BS
Bis-fwd 2 GAGGGTGAATTAGGTTTGGAAGGGG BS
Bis-rev 2 CAACCCACACTAATCAATTACACCC BS
Bis-fwd 3 GAGTTGTTGGTTTTATTTGGTTTAGGAGGGTGAG BS
Bis-rev 3 CTATTCTACTTATATATAACTCCAAAATCACACAC BS
  1. a Sequences protected in DNase I footprinting are underlined; mutated nucleotides are indicated in bold italics.
  2. b RT-PCR, reverse transcription PCR; LA, Luciferase assay; EMSA, electrophoretic mobility shift assay; BS, bisulfite sequencing.