Skip to main content

Advertisement

Table 3 Nucleotide sequences of primers and the PCR product size of GAPDH, ACTB, RBP5 and SCD genes

From: Long-term stability of RNA in post-mortem bovine skeletal muscle, liver and subcutaneous adipose tissues

Gene Primer sequence Product (bp)
GAPDH Forward 5'GCATCGTGGAGGGACTTATGA 3' 67
[GeneBank:U85042] Reverse 5'GGGCCATCCACAGTCTTCTG 3'  
ACTB Forward 5'CGCCATGGATGATGATATTGC 3' 66
[GeneBank:AY141970] Reverse 5'AAGCGGCCTTGCACAT 3'  
RBP5 Forward 5'GACGCAAATGCCAGACCATA 3' 51
[GeneBank:XM_587041] Reverse 5'CACAAACCAGCTGCTCCTCTT 3'  
SCD Forward 5'GCTGCTTGTGCGCAAACA 3' 72
[GeneBank:AB075020] Reverse 5'TCGGCTCTTAGGTCGGATAAATT 3'  
  Probe 5'CAGCTGTCAAAGAAAAGGGTTCCACGCT 3'