Skip to main content

Table 1 Primers and TaqMan probes

From: Alternative promoter usage of the membrane glycoprotein CD36

Assay Forward PCR primer Reverse PCR primer TaqMan probe
Exon 1c catctccgaaagcaagctcttcta aggaaatgaactgatgagtcacagaaa attggaaagctatcaacttc
Exon 1a catttgtggccttgtgctctt tgatgagtcacagaaagaatcaattcgt atcggacttctaatgatagctt
Exon 1f ggttacaagcatgacttctattaaacctat aatgaactgatgagtcacagaaagaatc tagctttccaatgattagacg
Exon 1b atgttggagcatttgattgaaaaatcctt aggaaatgaactgatgagtcacagaaa attggaaagctatctttaaaatg
Exon 1e ctgtataaatactcctaagaagttatataggaggacag caggaaatgaactgatgagtcacaga cattggaaagctatcttttttc
Exon 3–4 gagacctgcttatccagaagacaat ttctgtgcctgttttaacccaattttt aggacaacttgctttt
RPLP0 ccattctatcatcaacgggtacaa agcaagtgggaaggtgtaatcc tctccacagacaaggccaggactcgt