Skip to main content

Table 1 Integration efficiency of vectors carrying attP core modifications

From: Modification of the mycobacteriophage Ms6 attP core allows the integration of multiple vectors into different tRNAala T-loops in slow- and fast-growing mycobacteria

Vector 26 bp core attPa Integration efficiency/pAV6950b   % integration into the tRNAalaT-loopc  
   M. smegmatis M. bovis BCG M. smegmatis M. bovis BCG
pAV6950 AGGGGTTCGAATCCCCTTAGCTCCAC 100% 100% 100% in tRNAalaU 100% in tRNAalaV
  1. a: Changes introduced by site-directed mutagenesis, with respect to the original attP site from pAV6950 are indicated in bold
  2. b: Identical amounts of plasmid DNA were used to electroporate competent M. smegmatis or BCG. Integrants were numbered and the percentage of [integrants with modified attP/integrants with pAV6950] was calculated.
  3. c: The insertion locus was determined by PCR amplification and the percentage of clones in the given tRNAala T-loop was calculated