Skip to main content

Table 2 Sequence information for primers and probes used.

From: Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR

Gene Oligo Exon boundary Sequence – 5' to 3'
ACTB    Assay by design (ABI)
AHSP AHSP Forward 2 to 3 CTGAATCAGCAGGTCTTCAATGATC
  AHSP Reverse   GTCCCTGTACTTGGCCAGGA
  AHSP Probe   FAM-TCGTCTCTGAAGAAGACATGGTGACTGTGG -TAMRA
B2M B2M Forward   GAGTATGCCTGCCGTGTG
  B2M Reverse   AATCCAAATGCGGCATCT
  B2M Probe 2 to 4 FAM-CCTCCATGATGCTGCTTACATGTCTC-TAMRA
HBG2 HBG2 Forward   CTGCACTGTGACAAGCTGCAT
  HBG2 Reverse   CGAAATGGATTGCCAAAACG
  HBG2 Probe 2 to 3 FAM-CCAGCACATTTCCCAGGAGCTTGAAGT-MGB
GAPDH    Assay by design (ABI)
HBS1L HBS1L Forward   AAGGACAAGAATGAGGCAACAGTAT
  HBS1L Reverse   TTTGGCACAATTTCAGATTCACTT
  HBS1L Probe 4 to 5 FAM-AGCAAAAGGAAAACCAGTAGATTCCCAGACATC-TAMRA
HPRT1    Assay by design (ABI)
SDHA    Assay by design (ABI)
  1. AHSP (alpha haemoglobin stabilising protein), B2M (beta-2-microglobulin), HBG2 (γ-globin), GAPDH (glyceraldehyde 3-phosphate dehydrogenase), HBS1L (HBS1-like protein), HPRT (hypoxanthine-guanine phosphoribosyltransferase), and SDHA (succinate dehydrogenase).