Skip to main content

Table 2 Details of primers and amplicons for each of the 10 evaluated genes.

From: Selection of reference genes for quantitative RT-PCR studies in striped dolphin (Stenella coeruleoalba) skin biopsies

Gene Forward Primer Sequence [5'→3'] Position in cDNA Reverse Primer Sequence [5'→3'] Position in cDNA Amplicon Length E% R2
Act-B CCATCGGCAATGAGCGGTTCC 3rd Exon CGTGTTGGCATACAGGTCCTTCC 4th Exon 146bp 97.9 0.997
B2M TGGCTCCTTTCGTGACCTTGG 1st Exon GTCGTGAGTAAACCTGAACCTTCG 2nd Exon 96bp 99 0.996
GAPDH CAAGGCTGTGGGCAAGGTCATC 7th Exon TTCTCCAGGCGGCAGGTCAG 7th Exon 111bp 97.4 0.995
HPRT1 GTCAAGCAGCATAATCCAAAGATG 6th Exon GTCTGGTCTATATCCAACACTTCG 7th Exon 84bp 98.1 0.998
PGK1 ACAATGGAGCCAAGTCAG 3rd Exon CACGCAGTCCTTCAAGAAC 4th Exon 146bp 97.4 0.996
RPL4 CAGACCTTAGCAGAATCTTGAAAAGC 8th Exon CCTGGCGAAGAATGGTGTTCC 9th Exon 171bp 99.9 0.998
RPS18 CAATTAAGGGTGTGGGGCGAAG 2nd/3rd Exon TCTTGTATTGGCGTGGATTCTGC 4th Exon 141bp 100.8 0.999
SDHA TCTTTCCCACCAGGTCACACAC 3rd Exon CCAGTCGGAGCCCTTCACG 4th Exon 119bp 88.2 0.993
TFRC ACCATCTCAGTCATCAGGATTG 8th Exon CATTCTTGTTCTGTGAGGATACC 9th Exon 152bp 98.1 0.998
YWHAZ AAATGAAAGGAGACTACTACCGCTA 2nd Exon AGACCCAATCTGATAGGATGTGTTG 3rd Exon 151bp 95.9 0.994
  1. Primers are located in different exons, except for GAPDH, where primers are located in the same exon. E is a measure of real-time reaction efficiency and R2 indicates reproducibility of the reaction.