Skip to main content

Advertisement

Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 1 Primer pairs used for hTERT PCR analysis

From: Characterization of novel alternative splicing sites in human telomerase reverse transcriptase (hTERT): analysis of expression and mutual correlation in mRNA isoforms from normal and tumour tissues

Target 1) Primer pair 2) Ampl. (bp)
intron 2–15 p1255: ggaattctggagctgcttgggaacca
m3652: cgtctagagccggacactcagccttca
2409
intron 2 p1252: tgtttctggagctgcttgggaacca
m1725: tcatcagccagtgcaggaacttg
474
intron 2–3 p1509: tggggctccaggcacaacgaa
m1955: cttggggatgaagcggagtct
447
intron 4 p1870: tgcgggagctgtcggaagcagag
m2170: cgcacacgcagcacgaaggt
301
intron 5–9 p2182: cgccgcctgagctgtactttgtc
m2681: gctctagatccaccaaacgcaggagca
507
intron 10–13 p2660: gctgctcctgcgtttggtggatgat
m3164: ggggttcttccaaacttgctgatg
505
intron 14–15 p3194: ggcctccctctgctactccatcct
m3652: cgtctagagccggacactcagccttca
466
intron 14–15 p3194: ggcctccctctgctactccatcct
m3925: gggcacacctttggtcactcc
732
  1. 1) Positions of indicated introns are included in PCR product. 2) Primer sequences are from 5' to 3'. p, forward primer; m, reverse primer.