Skip to main content

Advertisement

Table 1 Primer pairs used for hTERT PCR analysis

From: Characterization of novel alternative splicing sites in human telomerase reverse transcriptase (hTERT): analysis of expression and mutual correlation in mRNA isoforms from normal and tumour tissues

Target 1) Primer pair 2) Ampl. (bp)
intron 2–15 p1255: ggaattctggagctgcttgggaacca m3652: cgtctagagccggacactcagccttca 2409
intron 2 p1252: tgtttctggagctgcttgggaacca m1725: tcatcagccagtgcaggaacttg 474
intron 2–3 p1509: tggggctccaggcacaacgaa m1955: cttggggatgaagcggagtct 447
intron 4 p1870: tgcgggagctgtcggaagcagag m2170: cgcacacgcagcacgaaggt 301
intron 5–9 p2182: cgccgcctgagctgtactttgtc m2681: gctctagatccaccaaacgcaggagca 507
intron 10–13 p2660: gctgctcctgcgtttggtggatgat m3164: ggggttcttccaaacttgctgatg 505
intron 14–15 p3194: ggcctccctctgctactccatcct m3652: cgtctagagccggacactcagccttca 466
intron 14–15 p3194: ggcctccctctgctactccatcct m3925: gggcacacctttggtcactcc 732
  1. 1) Positions of indicated introns are included in PCR product. 2) Primer sequences are from 5' to 3'. p, forward primer; m, reverse primer.