Skip to main content

Table 4 Primer and MGB Taqman probe sequences and concentrations used in real time PCR.

From: Development and evaluation of different normalization strategies for gene expression studies in Candida albicans biofilms by real-time PCR

Gene symbol Primer/probe Gene Sequence (5'-3') Concentration (nM)
ACT1 Forward TTTCATCTTCTGTATCAGAGGAACTTATTT 300
  Reverse ATGGGATGAATCATCAAACAAGAG 300
  MGB probe ATTATTTTCGTCACGGGTATT 300
RPP2B Forward TGCTTACTTATTGTTAGTTCAAGGTGGTA 300
  Reverse CAACACCAACGGATTCCAATAAA 300
  MGB probe CACCTCTCCATCAGCTT 200
TDH1 (GAPDH) Forward CGGTCCATCCCACAAGGA 300
  Reverse AGTGGAAGATGGGATAATGTTACCA 300
  MGB probe AGGTGGTAGAACTGC 200
PMA1 Forward TTGCTTATGATAATGCTCCATACGA 300
  Reverse TACCCCACAATCTTGGCAAGT 300
  MGB probe CCAAAACCAGTTAAATGG 200
LSC2 Forward CGTCAACATCTTTGGTGGTATTGT 900
  Reverse TTGGTGGCAGCAATTAAACCT 900
  MGB probe AGATGTGATTACGTCGCCA 400
CPA1 Forward TCTGGTGTTGCTGCCATAACTG 300
  Reverse AATTCTCCCCAATGATGAACCTT 300
  MGB probe AGACAATTGGTGAGTTATT 200
IMH 3 Forward TATTCATATGGCATTATTGGGTGGTA 600
  Reverse AACCATTTCTGCTTGTTCTTCAGA 600
  MGB probe TGGTATCATTCATCATAACTGTAC 400
RIP Forward TGTCACGGTTCCCATTATGATATTT 300
  Reverse TGGAATTTCCAAGTTCAATGGA 300
  MGB probe TGGTAGAATTAGAAAGGGTCCA 200
ALS1 Forward CAACAGGCACCTCAGCATCTAC 300
  Reverse CTCCACCAGTAACAGATCCACTAGTAA 300
  MGB probe AGTGCTAATAGCGAACTT 300
ALS3 Forward CAACTTGGGTTATTGAAACAAAAACA 300
  Reverse AGAAACAGAAACCCAAGAACAACCT 300
  MGB probe AAACTAGCTGTGAAGGTGAT 300