Skip to main content

Advertisement

Table 1 List of oligonucleotides used in this study

From: Flexible promoter architecture requirements for coactivator recruitment

Plasmid construction
Oligo name Sequence (5'→ 3') [restriction sites underlined]
HIS3_F_BamHI CGGGATCC CGAAGATGACAGAGCAGAAAGC
HIS3_R CCTCGTTCAGAATGACACG
MEL1_NcoI_W CCCTGAAAGGTTTTTCCATGG AATAGTCAGGACGC
MEL1_NcoI_C GCGTCCTGACTATTCCATGG AAAAACCTTTCAGGG
ATG_W GTAATAAAAGCAACGACGTTGAACGGATCCCGAAAG
ATG_C CTTTCGGGATCCGTTCAACGTCGTTGCTTTTATTAC
pMH14-F_ApaI ATAGGGCCC GGAAATTTGTGTAAAACCCCC
pMH14-R_AscI-SacII AACAACCGCGG ATAATGGCGCGCC CCTCGTTCAGAATGACACG
pUG73_F AAGGCGCGCC GCATAGGCCACTAGTGGATCTG
pUG73_R AGTAAGGCGCGCC CAGCTGAAGCTTCGTACGC
Promoter library construction  
Oligo name Sequence (5'→ 3') [restriction sites underlined]
MET16_reverse CCGCTCGAGTTACTGAAGTTG
Cbf1_6_Met31 CATGCCATGG TATCATCATTTCACGTGGCCACAACTTCAGTAACTCGAG CGG
Cbf1_8_Met31 CATGCCATGG TATCATCATTTCACGTGGNNCCACAACTTCAGTAACTCGAG CGG
Cbf1_10_Met31 CATGCCATGG TATCATCATTTCACGTGGNNNNCCACAACTTCAGTAACTCGAG CGG
Cbf1_12_Met31 CATGCCATGG TATCATCATTTCACGTGGNNNNNNCCACAACTTCAGTAACTCGAG CGG
Cbf1_14_Met31 CATGCCATGG TATCATCATTTCACGTGGNNNNNNNNCCACAACTTCAGTAACTCGAG CGG
Cbf1_16_Met31 CATGCCATGG TATCATCATTTCACGTGGNNNNNNNNNNCCACAACTTCAGTAACTCGAG CGG
Cbf1_18_Met31 CATGCCATGG TATCATCATTTCACGTGGNNNNNNNNNNNNCCACAACTTCAGTAACTCGAG CGG
Cbf1_20_Met31 CATGCCATGG TATCATCATTTCACGTGGNNNNNNNNNNNNNNCCACAACTTCAGTAACTCGAG CGG
Cbf1_22_Met31 CATGCCATGG TATCATCATTTCACGTGGNNNNNNNNNNNNNNNNCCACAACTTCAGTAACTCGAG CGG
Cbf1_24_Met31 CATGCCATGG TATCATCATTTCACGTGGNNNNNNNNNNNNNNNNNNCCACAACTTCAGTAACTCGAG CGG
Cbf1_26_Met31 CATGCCATGG TATCATCATTTCACGTGGNNNNNNNNNNNNNNNNNNNNCCACAACTTCAGTAACTCGAG CGG
Cbf1_28_Met31 CATGCCATGG TATCATCATTTCACGTGGNNNNNNNNNNNNNNNNNNNNNNCCACAACTTCAGTAACTCGAG CGG
Cbf1_30_Met31 CATGCCATGG TATCATCATTTCACGTGGNNNNNNNNNNNNNNNNNNNNNNNNCCACAACTTCAGTAACTCGAG CGG
Cbf1_32_Met31 CATGCCATGG TATCATCATTTCACGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNCCACAACTTCAGTAACTCGAG CGG
Cbf1_34_Met31 CATGCCATGG TATCATCATTTCACGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACAACTTCAGTAACTCGAG CGG