Skip to main content

Table 1 Oligonucleotides used as primers in RT-PCR analysis

From: Comparing protocols for preparation of DNA-free total yeast RNA suitable for RT-PCR

Target mRNA Primer Sequence Amplicon Size (bp)
TPS1 Forward CGCTAAGGCGCAACTGACCTCGTCT
Reverse CGACGAGAATGCGTGGTTGGCATAC
379
TPS2 Forward CCCCCCAAACTATCAGATTGGAACAAC
Reverse ACCCAGCTGCAGCTATTCCATCGGC
612
PDA1 Forward GGTCAGGAGGCCATTGCTGT
Reverse GACCAGCAATTGGATCGTTCTTGG
673
CNA1 Forward CGAAAGACTTGAATTCTTCACGCATC
Reverse GAATGATCTGCAGCAAGCATCG
629
CNA2 Forward CCTTATATCTGTTCCCGCCC
Reverse GAGGAACCATGGTTTTGGAG
551
ACT1 Forward CCTACGTTGGTGATGAAGCT
Reverse GTCAGTCAAATCTCTACCGG
407
  1. CNA1, CNA2, PDA1 and ACT1 primer sequences were obtained from Del Aguila et al, 2003 and TPS1 and TPS2, from Souza, 2001.