Skip to main content

Table 2 Primers for Real-Time PCR

From: Selection of reference genes for gene expression studies in human neutrophils by real-time PCR

Gene symbol Length Position in cDNA Sequence (5'-3')
ABL1 20 Exon 7 1217-1236 TGACAGGGGACACCTACACA
  20 Exon 9 1535-1516 TCAAAGGCTTGGTGGATTTC
ACTB 20 Exon 2 210-229 CATCGAGCACGGCATCGTCA
  21 Exon 3 420-400 TAGCACAGCCTGGATAGCAAC
B2M 19 Exon 2 268-287 ACTGAATTCACCCCCACTGA
  20 Exon 4 381-362 CCTCCATGATGCTGCTTACA
GAPD 20 Exon 7 728-747 TGGACCTGACCTGCCGTCTA
  22 Exon 8 970-948 CCCTGTTGCTGTAGCCAAATTC
GNB2L1 20 Exon 3 327-346 GAGTGTGGCCTTCTCCTCTG
  20 Exon 5 550-531 GCTTGCAGTTAGCCAGGTTC
HRPT1 20 Exon 4 322-341 GACCAGTCAACAGGGGACAT
  22 Exon 7 516-495 AACACTTCGTGGGGTCCTTTTC
PBGD 18 Exon 11-12 764-781 AGGATGGGCAACTGTACC
  20 Exon 13 995-976 GTTTTGGCTCCTTTGCTCAG
RPL32 19 Exon 1/2 33-51 CATCTCCTTCTCGGCATCA
  20 Exon 3 185-166 AACCCTGTTGTCAATGCCTC
TBP 20 Exon 4 623-642 GAACCACGGCACTGATTTTC
  20 Exon 5 780-761 CCCCACCATGTTCTGAATCT
TUBB 20 Exon 3 240-259 CTTCGGCCAGATCTTCAGAC
  20 Exon 4 416-397 AGAGAGTGGGTCAGCTGGAA