Skip to main content

Table 1 TaqMan assays used to evaluate potential reference genes in Atlantic salmon.

From: Evaluation of potential reference genes in real-time RT-PCR studies of Atlantic salmon

Gene Forward primer Reverse primer TaqMan MGB probe Amplicon size (bp)
18S rRNA CCCCGTAATTGGAATGAGTACACTTT ACGCTATTGGAGCTGGAATTACC CACCAGACTTGCCCTCC 98
S20 GCAGACCTTATCCGTGGAGCTA TGGTGATGCGCAGAGTCTTG CCTCAAGGTGAAGGGA 85
β-actin CCAAAGCCAACAGGGAGAAG AGGGACAACACTGCCTGGAT TGACCCAGATCATGTTT 91
GAPDH AAGTGAAGCAGGAGGGTGGAA CAGCCTCACCCCATTTGATG CTGATCATTGGAAACCT 96
EF1AA CCCCTCCAGGACGTTTACAAA CACACGGCCCACAGGTACA ATCGGTGGTATTGGAAC 57
EF1AB TGCCCCTCCAGGATGTCTAC CACGGCCCACAGGTACTG CCAATACCGCCGATTTT 59