Skip to main content

Advertisement

Table 2 Primers used for amplification and cloning of the phosphatase cDNAs

From: Post-translational generation of constitutively active cores from larger phosphatases in the malaria parasite, Plasmodium falciparum: implications for proteomics

cDNA cloned Primer pair
PfCnA N6CTCGAG GAACCACTGCCTGATCCGAAG
  N6GGATCC TTATTCGTTGGATGGCCTCTTTTCGT
PfCnB N6GCTAGC ATGGGAAACACACAAGCGATATTATC
  N6CTCGAG TAATTCTAGCTTCAATTTATTTCCAAC
PfPP7 N6CTCGAG GAAAATTACAACATTGAAGATGTTG
  N6GGATCC TTAATTATTTGAATATATATATGTAGGC
  1. In each pair, the first primer is the 5' sense primer, and second one is the 3' antisense primer. All primers contained a random hexanucleotide sequence (N6) for efficient restriction of the PCR product, followed by restriction sites (underlined): XhoI (CTCGAG), BamHI (GGATCC), NheI (GCTAGC). All sequences are written 5' → 3'. Note that the natural start codons (ATG) of both PfCnA and PfPP7 were removed because translation would originate from the upstream ATG of the pET-15b vector (in order to add the N-terminal His-tag). In PfCnB, the ATG was left intact but the stop codon was removed so that translation could continue into the pET-23a vector to add the C-terminal His-tag.