Skip to main content

Table 1 Primer and probe sequences for amplification and detection

From: A novel, non-radioactive eukaryotic in vitro transcription assay for sensitive quantification of RNA polymerase II activity

Template Primer/oligo Sequence 5′-3′ Modification Amplicon/probe
Plasmid pEGFP-N1 CMV-EGFP-frw GGGGCGGAGCCTATGGAAAA - PCR product: (5′ biotinyl-)CMV-EGFP, 1136 bp
Btn-CMV-EGFP-frw GGGGCGGAGCCTATGGAAAA 5′ biotin
CMV-EGFP-rev TGTCGCCCTCGAACTTCACCTC -
CMV-EGFP EGFPfrw1 TGAGCAAGGGCGAGGAGCTGTT - PCR/qPCR product, 295 bp
EGFPrev1 AAGATGGTGCGCTCCTGGACGT -
EGFPfrw2 GTGACCACCCTGACCTAC - qPCR product, 83 bp
EGFPrev2 ATGGCGGACTTGAAGAAG -
EGFP-LNA1 CAGtGCtTCaGCcGCTA* 5′ FAM, 3′ BHQ1, LNA-oligo* qPCR dual labeled probe
HeLaScribe ‘Positive Control DNA’** HELA NUCLEAR FW CTCATGTTTGACAGCTTATCGATCCGGGC - PCR product: (5′ biotinyl-)HS-DNA, 1182 bp
Btn-HELA NUCLEAR FW CTCATGTTTGACAGCTTATCGATCCGGGC 5′ biotin
HELA NUCLEAR RV ACAGGACGGGTGTGGTCGCCATGAT -
HS-DNA HNqPCRfrw1 GCCGGGCCTCTTGCGGGATAT - qPCR product, 132 bp
HNqPCRrev1 CGGCCAAAGCGGTCGGACAGT -
HNqPCRfrw6 GTCCATTCCGACAGCATCGCCA - qPCR product, 144 bp
HNqPCRrev6 GGCTCCAAGTAGCGAAGCGAGC -
HN_SONDE1 TGGCGTGCTGCTAGCGCTAT 5′ FAM, 3′ BHQ qPCR dual labeled probe
  1. *Locked Nucleic Acid (LNA) - bases are depicted as lower case.
  2. **‘Positive Control DNA’ is provided with the Promega ‘HeLaScribe Nuclear Extract in vitro Transcription System’. Its DNA sequence is provided within the Additional file 1 “HeLaScribe Positive Control DNA Sequence”.