Skip to main content

Table 5 RT-qPCR target gene primer sequences and characteristics

From: Gene expression studies for the analysis of domoic acid production in the marine diatom Pseudo-nitzschia multiseries

Predicted gene product Primer sequence GC (%) Tm (°C)a Amplicon (bp) Ex-Ex Spanningb Efficiency (%) R2
Cycloisomerase F: TCATAGGTGGCGTCAAGAACGTGT 50.0 60.3 127 No 99.5 0.995
  R: TCAGCTTGTCGTGCCGAAATTGTG 50.0 60.3     
SLC6 F: TCGGACACTACGGAGACTACG 57.1 57.1 73 No 104.2 0.997
  R: ACCAAGGTGAAGGCGACG 61.1 58.0     
SLC6 Ex-Ex F: CATGCACGATACTGTCTATTTCG 43.5 53.6 122 Yes 100.0 0.998
  R: CGTCCAACCAAAATAAGCCAGC 50.0 57.0     
Aldo-keto reductase F: GAATGGGCTACGGAGAGACG 60.0 57.3 114 No 99.5 0.998
  R: GTACAGGCGTGAATTTGGTAGC 50.0 56.2     
sHSP F: GACGAAGGATTCATCACCGTCG 54.5 57.7 141 No 102.9 0.998
  R: GACACCGTTGTCGAGGGTAG 60.0 57.4     
PEPCK F: GCATTGCTCTGCAAACGTCG 55.0 57.7 107 No 100.0 0.997
  R: CAATCAAGGCTCGGTGAGGATC 54.5 57.7     
GDH F: CAATGCCATCAACGCCATCAAGGA 50.0 60.2 128 No 98.4 0.998
  R: CAAAGCCGAGGTTGGCAAGAGTTT 50.0 60.3     
PFK F: CGAGGTGGCATCCAAACGATTGC 56.5 61.1 84 No 105.1 0.998
  R: GCAGCCTGTGTATTGGTATCGTCG 54.1 59.7     
PFK Ex-Ex F: GGAGAAAATCCGCTCGAGGTG 57.1 57.9 111 Yes 99.4 0.997
  R: CTTTGAGAGAACCGCAGCCTG 57.1 58.4     
FCP F: CGTCTCATACCACGGCAC 61.1 55.7 184 No 97.8 0.997
  R: CTTGGATTGATGGTCCACGAG 52.3 55.6     
  1. aThe annealing temperature for all standard curve analyses was performed at 60°C to demonstrate the efficiency of the primer sets under our assay conditions; the calculated Tm values are provided for reference.
  2. b'Ex-Ex spanning’ refers to primers that span an exon-exon junction; these primer sets did not yield a product using gDNA as a template.