Skip to main content

Advertisement

Table 1 Oligonucleotide primers used in this study

From: Screening and analysis of PoAkirin1 and two related genes in response to immunological stimulants in the Japanese flounder (Paralichthys olivaceus)

Name Sequence Purpose used
AKI-F-S1 ATGGCCTGCGGAGCGACGTT ORF amplification
AKI-F-A1 TCAGGAGACATAACTAGCAGGCCG ORF amplification
β-actin-s1 GCTGTGCTGTCCCTGTA RT-PCR
β-actin-a1 GAGTAGCCACGCTCTGTC RT-PCR
GAP-S1 CAACGGCGACACTCACTCCTC RT-PCR
GAP-A1 TCGCAGACACGGTTGCTGTAG RT-PCR
TUBA-S1 TGACATCACAAACGCCTGCTTC RT-PCR
TUBA-A1 GCACCACATCTCCACGGTACAG RT-PCR
AKI-R-S1 AGGACCAGCCCTCGTTCACACT RT-PCR
AKI-R-A1 TCCGTATCTTCGCATGATCTGGT RT-PCR
HEPN-R-S1 TACAAGGACAATGGTGGGGG RT-PCR
HEPN-R-A1 GGCAAGGGCTGAGATGGAG RT-PCR
C1q-R-S1 CTCCAGAAAACGAAGCAGGC RT-PCR
C1q-R-A1 TGTCGCACATCATCAAGTGAAC RT-PCR
AKI-F-A7 GCGTCGACGGAGACATAACTAGCAG Plasmid construction
AKI-T-A1 GCGGTACCGGAGACATAACTAGCAG Plasmid construction
AD-AKI-S1 GTGAATTCATGGCCTGCGGAGCGACGTT Plasmid construction
AD-AKI-A1 CAGCTCGAGTCAGGAGACATAACTAGCAG Plasmid construction
C1q-S1 GCCGAATTCAAGGGGGCACCAGGTCTTAA Plasmid construction
C1q-A1 CAGGTCGACTCAGGCCGTGGGGAAGACGA Plasmid construction
HEPN-S3 GTGAATTCGGCACGAGGCTCAGGTGGCA Plasmid construction
HEPN-A2 CAGCTCGAGAGCCTCCTCTTTGTTTGGCC Plasmid construction
HEPN-A3 CAGCTCGAGGGAAGGTTGACCGTGCCTTT Plasmid construction
HEPN-S5 AGTGAATTCTCTGGCAGCTCCATCTCAGC Plasmid construction
HEPN-A4 CAGCTCGAGCTATTTCACATATGCCTCAAC Plasmid construction
HEPN-ET-S1 CCGAATTCAGGCTCAGGTGGCATCCT Plasmid construction
HEPN-ET-A1 GTGCTCGAGCTATTTCACATATGCCTCA Plasmid construction