Skip to main content

Advertisement

Table 1 The primers for site-directed mutation PCR

From: A point mutation in the DNA-binding domain of HPV-2 E2 protein increases its DNA-binding capacity and reverses its transcriptional regulatory activity on the viral early promoter

Primers The sequence of the primers Enzyme site
E2-up 5'AAGCTTATGGAAACACTGGCGAACCGT3' Hind III
E2-down 5'GGATCCTTATACAAATGCAGACATATACCC3' BamHI
E2N-down 5'GGATCCTTATGATTCTGCTGAGGC3' BamHI
E2C-up 5'CTTAAGGTGGCTGGGACTGTTATTCAC3' Hind III
118-up 5'CAGTACTAGTGAAATTTGATGGCAGC3' \
118-down 5'GCTGCCATCAAATTTCACTAGTACTG3' \
235-up 5'CAGAACCAACAGGAGCAGGAAG3' \
235-down 5'GTGGAGGACACCCTGGCATAC3' \
338-up 5'GTATGCCAGGGTGTCCTCCAC3' \
338-down 5'GTGGAGGACACCCTGGCATAC3' \
m338-up 5'GTATGTCAGGGTGTCCTCCAC3' \
m338-down 5'GTGGAGGACACCCTGACATAC3' \
E2-P-up 5'GGATCCATGGAAACACTGGCGAACCGT3' BamHI
E2N-P-down 5'GAATTCTTATGATTCTGCTGAGGC3' EcoRI
E2C-P-up 5'GGATCCGTGGCTGGGACTGTTATTCAC3' BamHI
E2-P-down 5'GAATTCTTATACAAATGCAGACATATACCC3' EcoRI
E2-P-117-up 5'GGATCCTACATCCGCATCTGTGTCTAG3' BamHI