Skip to main content

Table 1 Primer sequences for the Real-Time PCR Analysis

From: PIM-1 kinase interacts with the DNA binding domain of the vitamin D receptor: a further kinase implicated in 1,25-(OH)2D3 signaling

gene name Abbreviation Acc No   Sequence Product size
Annexin ANXA1 NM_000700 forward 5´- GCAGGCCTGGTTTATTGAAA −3´ 203 bp
reverse 5´- GCTGTGCATTGTTTCGCTTA −3´
Cyp24A1 CYP24 NM_000782 forward 5´- GGCAACAGTTCTGGGTGAAT −3´ 249 bp
reverse 5´- TATTTGCGGACAATCCAACA −3´
Osteopontin ON NM_000582 forward 5´- TGAAACGAGTCAGCTGGATG −3´ 162 bp
reverse 5´- TGAAATTCATGGCTGTGGAA −3´
PIM-1 kinase PIM1 NM_002648 forward 5´- CAGAGTGGATCCGCTACCAT −3´ 226 bp
reverse 5´- TGGATTTCTTCGAAGGTTGG −3´